ACCU BEKAS

DEFENSIVE DRIVER BEHAVIOUR

2009-05-07T16:07:00.000+07:00

Tujuan DDB adalah untuk menghindarkan terjadinya kecelakaan kendaraan

bermotor dimanapun dan kapanpun.

Keselamatan adalah kunci sukses anda bekerja, tidak ada arti yang lain jika

anda mendapatkan kecelakaan dalam bentuk apapun, karena setiap

kecelakaan menimbulkan kerugian baik phisik maupun non phisik.

Maka untuk itu anda diharuskan mematuhi semua aturan-aturan yang

berhubungan dengan Keselamatan Kendaraan Bermotor yang berlaku di

daerah kerja Perusahaan seperti berikut;

A. Surat Izin Mengemudi

Hanya pegawai yang memiliki surat izin mengemudi (SIM) saja yang diizinkan

untuk mengendarai kendaraan bermotor perusahaan dan kendaraan.

B. Tanggung Jawab Pengemudi

1. Mengemudi tanpa kecelakaan untuk urusan Perusahaan merupakan kunci

tanggung jawab tugas. Hal ini merupakan sikap seorang pengemudi profesional.

a) Seorang pengemudi profesional harus bersikap sempurna untuk menjaga

agar pada setiap perjalanan tidak terjadi kecelakaan, tidak ada hampir terjadi

kecelakaan, tidak ada pelanggaran lalu lintas, tidak ada keterlambatan, tidak

ada kerusakan mekanis yang disebabkan oleh kelalaian mengemudi.

b) Sikap seorang pengemudi profesional dibuktikan dari tanggung jawabnya

terhadap yang berikut:

− melakukan pemeriksaan pra-perjalanan atas kendaraan dan peralatan

darurat

− menjaga keselamatan penumpang, termasuk penggunaan sabuk pengaman

oleh setiap orang,

− melaporkan kerusakan untuk dilakukan perbaikan,

− merencanakan rute,

− mematuhi undang-undang lalu-lintas, dan

− menjadi pengemudi yang defensif.

c) Mencegah terjadinya kecelakaan walaupun cuaca buruk, kesalahan orang

lain, keadaan jalan yang buruk dll.

2. Pengemudi kendaraan Perusahaan juga bertanggung jawab atas keselamatan

pegawai yang membantu memunggah atau menurunkan muatan, atau mereka

yang bekerja diatas atau di sekitar kendaraan.

3. Semua pengemudi harus mengikuti kursus mengemudi defensif, ikut serta

dalam program penjelasan serta mengikuti kursus penyegar setengah hari

setiap dua atau tiga tahun sekali.

4. Pengemudi bertanggung jawab terhadap akibat pelanggaran.

5. Pengemudi CPI harus melakukan pemeriksaan pra-perjalanan mengenai:

a. Registrasi kendaraan yang masih berlaku

b. Prosedur kecelakaan / perbaikan

c. Kondisi dan operasi setiap bagian kendaraan

6. Pengemudi tidak diizinkan mengoperasikan peralatan perusahaan yang rusak

atau tidak menurut undang-undang.

C. Prinsip-Prinsip Mengemudi Defensif

Semua pengemudi harus mengikuti teknik dan taktik mengemudi dengan defensif

berikut:

1. Sasaran Sempurna Dalam Mengemudi

a) Memandang berulang-ulang dalam zona rencana (30 detik + ke depan)

b) Memandang dengan konsisten selama 15 detik.

c) Melihat ke depan untuk mengantisipasi masalah.

d) Mengurangi kecepatan karena sasaran berkurang oleh kepadatan lalu-lintas,

tikungan, bukit, kabut, malam, hujan, dll.

e) Menjaga kendaraan agar tetap berada ditengah.

2. Usahakan Pandangan Yang Lebih Luas

a) Jarak mengikuti dari belakang yang baik: 4-6 detik dalam kondisi ideal; lebih

lama waktunya jika jalan basah/licin; lebih lama ketika dikuntil dari belakang.

b) Jarak mengiring yang cukup memberi kesempatan bagi mata untuk

memandang semua yang ada di sekitar kendaraan.

c) Membuat keputusan lebih awal.

3. Terus Melihat Sekeliling - Pada Ke-empat Sisi Kendaraan Plus

a) Gerakkan mata minimal setiap 2 detik.

b) Lihat kaca spion setiap 5 - 6 detik.

c) Perhatikan simpang sebelum masuk.

d) Hindarkan menatap lama-lama (staring) ketika menilai situasi (berhenti,

kurangi kecepatan, ubah posisi, lihat ke arah lain, bunyikan klakson)

e) Jarak mengiring yang cukup merupakan kunci untuk memperoleh waktu

mengerakkan pandangan.

4. Usahakan Siaga Penuh

a) Dekati persimpangan dengan mengurangi kecepatan hingga merasa pasti

untuk dapat masuk dengan aman dan bersiap untuk berhenti.

b) Dekati sebagian besar persimpangan, terutama persimpangan yang

terhalang, dengan meletakkan kaki pada pedal rem.

c) Jaga jarak sekeliling kendaraan dibahagian depan jika terjepit di tengah-

tengah.

d) Sesuaikan kecepatan untuk menghadapi tindakan pengemudi lain.

e) Pertahankan jarak mengiring yang tepat.

f) Tanya diri sendiri “Bagaimana jika ……? Bersiap-siap untuk menghadapi

tindakan orang lain, keadaan jalan, dan cuaca.

g) Ketika berhenti, jaga agar ada jarak satu kendaraan ke depan.

h) Patuhi peraturan mundur yang aman.

5. Pastikan Bahwa Mereka Melihat Anda

a) Komunikasikan keberadaan dan maksud anda kepada orang lain: bunyikan

klakson, gunakan lampu jauh, lampu rem dan tanda dengan tangan tangan.

b) Pandang mata pengemudi lain dan para pejalan kaki.

c) Hidupkan lampu jauh pada siang hari, terutama pada jalan dua jalur. Hal ini

membantu orang lain untuk melihat anda.

d) Ambil jalur yang benar jauh-jauh hari.

D. Memulai dengan Aman

Pengemudi kendaraan Perusahaan harus berjalan sekeliling kendaraan sebelum

menghidupkan kendaraan tersebut untuk memeriksa kemungkinan adanya

penghalang atau kondisi yang tidak menguntungkan.

E. Mundur dengan Aman

Hindari kecelakaan waktu mundur dengan mempraktekkan prinsip-prinsip

mengemudi defensif berikut:

1. Jika mungkin, JANGAN MUNDUR.

2. Jika masuk fasilitas atau lokasi lapangan, usahakan parkir dimana anda tidak

perlu mundur. Kecuali jika parkir di tempat parkir yang telah ditentukan.

3. Jika pada fasilitas/lokasi ada larangan berputar tanpa mundur, parkir pada jalan

raya dan masuk ke fasilitas dengan berjalan kaki.

4. Posisikan kendaraan anda agar gerakan awal anda nantinya adalah maju ke

depan.

5. Rencanakan parkir anda agar anda dapat maju ke depan jika berangkat nanti.

6. Jika aman, mundurkan kendaraan anda pada tempat parkir agar anda dapat

maju ketika siap untuk berangkat nanti.

7. Jika gerakan awal anda harus mundur, periksa di sekeliling kendaraan anda

sambil berjalan untuk memastikan bahwa ruangan tidak ada penghalang.

8. Mulai mundur dengan segera.

9. Mundur perlahan-lahan.

10. Gerakkan pandangan anda: gunakan kaca spion, lihat keluar jendela, dan putar

tubuh anda untuk melihat keluar melalui jendela belakang jika mungkin.

11. Mundur secukupnya saja sebelum dapat maju.

12. Bunyikan klakson atau gunakan alat lain untuk memastikan bahwa orang lain

melihat anda dan tidak akan bergerak ke ruangan yang anda tuju.

13. Gunakan pemandu jika perlu. Pastikan bahwa pemandu tersebut berdiri di

tempat yang aman, dan anda setuju dengan aba-aba tangan yang dibuatnya,

serta anda berdua saling berpandangan.

14. Sekali lagi, jika mungkin JANGAN MUNDUR!!!

F. Memarkir dengan Aman

1. Jangan parkir di belakang kendaraan lain atau dengan posisi yang menempatkan

kendaraan anda “tidak kelihatan ”oleh pengemudi kendaraan lain.

2. Kendaraan harus diparkir di pinggir jalan yang tidak menghalangi lalu-lintas dan

kendaraan lain.

3. Pintu harus ditutup.

4. Mesin dimatikan.

5. Pastikan bahwa transmisi pada posisi ”parkir” dan pasang rem tangan.

6. Untuk kendaraan yang diparkir pada penurunan dan pendakian:

a. Roda depan dihadapkan dengan benar ke trotoar atau pinggir jalan, dan

b. Pick-up dan truk, yaitu untuk operator lapangan, juru las, dll., roda belakang

harus “dihambat” dengan benar.

c. Pasang rem tangan.

7. Untuk kendaraan tanpa rem angin atau listrik, tidak dijaga:

a. Pasang transmisi otomatis pada posisi “parkir” atau transmisi standar pada

“gigi rendah” berlawanan dengan arah pendakian, serta

b. “Matikan” mesin,

c. Pasang rem tangan,

d. Hambat roda belakang.

8. Untuk kendaraan dengan rem angin atau rem listrik dengan power take-off:

a. Pasang rem tangan dan rem mikro (jika ada), dan

b. Hambat roda belakang dengan benar.

9. Untuk kendaraan dengan rem angin atau rem listrik, tidak menggunakan power

take-off - tidak dijaga:

a. “Matikan” mesin, dan

b. Pasang transmisi pada “gigi rendah”, dan

c. Pasang rem tangan atau rem mikro (jika ada).

G. Penggunaan Sabuk Pengaman

Pengemudi dan penumpang harus memasang sabuk pengaman mereka jika

mengendarai kendaraan perusahaan. Pengemudi bertanggung jawab atas

pemakaian sabuk pengaman oleh penumpang.

H. Pengoperasian yang Aman

1. Perkakas, peralatan, kertas, dll. tidak boleh dibiarkan berserakan dalam ruangan

truk atau ruangan penumpang. Gunakan chart holder atau clipboard untuk

kertas.

2. Memuat Barang

a) Truk atau kendaraan lain tidak boleh dimuat dengan beban melebihi batas

berat untuk barang atau penumpang yang telah ditetapkan.

b) Semua muatan kendaraan harus disusun rapi dan diikat, dan bagian belakang

yang menonjol 4 (empat) kaki melebihi badan kendaraan harus diberi

bendera merah.

c) Bahan peledak, racun serangga, cairan yang mudah menyala dan mudah

terbakar harus diangkut dalam kemasan yang aman diluar ruangan

penumpang. Semua persyaratan undang-undang untuk kemasan, plakat,

label, dll.harus dipatuhi.

d) Jika terjadi kerusakan, kendaraan harus diparkir diluar jalur jalan raya jika

mungkin.

e) Jika kerusakan terjadi dalam jarak 500 kaki dari tikungan, punggung bukit

atau penghalang pemandangan lain, pengemudi harus meletakkan tanda atau

alat peringatan (mis. segitiga merah atau alat yang bercahaya) ke arah yang

memberi peringatan kepada lalu-lintas. Alat pemberi peringatan harus

diletakkan tidak kurang dari 100 kaki atau tidak lebih dari 500 kaki dari

kendaraan yang rusak.

3. Penumpang

Penumpang harus diangkut pada tempat duduk yang telah ditentukan yang

dilengkapi dengan sabuk pengaman atau alat pengaman lain.

4. Telepon genggam.

Telepon genggam tidak boleh digunakan atau menjawab panggilan oleh si

pengemudi sewaktu kendaraan sedang berjalan. Pengemudi harus berhenti

keluar jalan sebelum menggunakan telepon genggam.

Flu Singapura (PENYAKIT)

2009-05-05T15:35:00.001+07:00

FLU SINGAPURA - HFMD - KTM
"Flu Singapura" sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.
EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ).
Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.
GAMBARAN KLINIK :
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :
o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.
Komplikasi penyakit ini adalah :
o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )
Satu kelompok dengan penyakit ini adalah :
1. Vesicular stomatitis dengan exanthem (KTM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10
LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
1. Deteksi Virus :
o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.
2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)
3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.
TATALAKSANA :
o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :
Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus
Extracorporeal membrane oxygenation.
o Pengobatan simptomatik :
Antiseptik didaerah mulut
Analgesik misal parasetamol
Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.
PENCEGAHAN DAN PENGENDALIAN PENYAKIT:
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)
UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.
Hand-Foot-Mouth Disease (HFMD)
Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 ? 6 Hari
Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 ? 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.
Diagnosis :
Manifestasi klinis dan isolasi virus dengan preparat Tzank.
Diagnosis Banding : Varisela, herpes
Terapi : Simptomatis
"Flu Singapura" sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.
EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.
GAMBARAN KLINIK :
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :
o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.
Komplikasi penyakit ini adalah :
o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )
Satu kelompok dengan penyakit ini adalah :
1. Vesicular stomatitis dengan exanthem (KTM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10
LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
1. Deteksi Virus :
o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.
2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)
3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.
TATALAKSANA :
o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :
Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus
Extracorporeal membrane oxygenation.
o Pengobatan simptomatik :
Antiseptik didaerah mulut Analgesik misal parasetamol Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.
PENCEGAHAN DAN PENGENDALIAN PENYAKIT:
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)
UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.
Hand-Foot-Mouth Disease (HFMD)
Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 ? 6 Hari
Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 ? 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.
Diagnosis :
Manifestasi klinis dan isolasi virus dengan preparat Tzank.
Diagnosis Banding : Varisela, herpes
Terapi : Simptomatis

---o0o---

Buka kaca mobil anda sebelum berkendaran !!!

2009-05-05T15:20:00.000+07:00

Jika Anda seorang yg mengendarai mobil silakan buka jendela
setelah Anda masuk mobil dan jangan terburu-buru menyalakan
AC. Hal ini dilakukan agar udara yg ada di dalam mobil bisa
segera keluar dan tergantikan dengan udara yg lebih segar.
Ternyata udara yg ada di dalam mobil (saat diparkir)
mengandung Benzene/Bensol. Darimanakah Benzene ini berasal??

Menurut penelitian yang dilakukan oleh UC, dashboard mobil,
sofa, air freshener akan memancarkan Benzene, hal ini bisa
disebabkan oleh suhu ruangan yg meninggi. (hati2 bila
mencium bau plastik terbakar di dalam mobil anda, segera cek
asal bau tersebut). Kalau tidak salah saya pernah membaca
thread tentang bahaya action figure yg kebakar di dalam
mobil.. Artikel ini berhubungan dengan thread tersebut (maaf
sampai sekarang saya belum bisa menemukan thread tersebut).

Tingkat Benzene yang dapat diterima dalam ruangan adalah 50?
mg per sq ft. Sebuah mobil yg parkir di ruangan dengan?
jendela tertutup akan berisi 400-800 mg dari Benzene. Jika?
parkir di luar rumah di bawah sinar matahari pada suhu di?
atas 60 derajat F, tingkat Benzene berjalan sampai 2000-4000?
mg, 40 kali dengan tingkat yang dapat diterima ..?
Orang-orang di dalam mobil pasti akan menyedot kelebihan?
jumlah toksin.?

***Bahaya Benzene...***

Efek singkat menghirup high level benzene dapat
mengakibatkan kematian, sedangkan menghirup low level
benzene dapat menyebabkan kantuk, pusing, mempercepat denyut
jantung, sakit kepala, tremors, kebingungan, dan ketidaksadaran.

Long term efeknya bisa menyebabkan kerusakan pada sumsum tulang
dan dapat menyebabkan penurunan sel darah merah, yang
mengarah ke anemia. Ia juga dapat menyebabkan perdarahan
yang berlebihan dan menurunkan system kekebalan,
meningkatkan kesempatan infeksi, menyebabkan leukemia dan
lainnya yang terkait dengan kanker darah dan pra-kanker dari darah.**

Benzene adalah toksin yang menyerang hati, ginjal,
paru-paru, jantung dan otak dan dapat menyebabkan kerusakan
kromosonal. Saat ini sedang diadakan penelitian tentang
pengaruh benzene terhadap tingkat kesuburan pria dan wanita.**?

Benzene adalah racun yg berbahaya karena tubuh kita kesulitan untuk
mengeluarkan jenis racun* ini.*?

Karena itu sangat disarankan agar Anda membuka jendela dan pintu untuk?
memberikan waktu pada udara yg ada di dalam agar keluar,
sebelum Anda masuk.*?

Semoga bermanfaat.. ..?

OHSAS 18001:2007

2009-04-01T16:52:00.006+07:00

Standar OHSAS 18001:2007 yang dipublikasikan pada bulan Juli 2007 ini lebih
berorientasi kepada hasil dibandingkan dengan versi sebelumnya. Standar ini disesuaikan
dengan ISO 9001:2000 dan ISO 14001:2004, sehingga memungkinkan untuk melakukan
sistem manajemen secara terpadu.
Apa yang berubah?
Standar OHSAS yang baru sangat berbeda dengan versi sebelumnya dengan perubahan
sebagai berikut:
1. Pentingnya "kesehatan" sekarang lebih ditekankan dan diseimbangkan dengan
keselamatan".
2. Lebih fokus kepada kesehatan dan keselamatan kerja, tidak termasuk aset, keamanan,
dan lain-lain.
3. Istilah "insiden" digunakan menggantikan "kecelakaan".
4. Elemen-elemen perilaku, kemampuan dan faktor-faktor manusia lainnya harus
dipertimbangkan dalam melakukan identifikasi bahaya-bahaya, penilaian risiko,
menetapkan pengendalian risiko dan akhirnya mempertimbangkan kompetensi,
pelatihan dan kepedulian.
5. Persyaratan baru:
a. delegasi pengendalian sebagai bagian dari perencanaan K3.
b. manajemen perubahan.
c. partisipasi dan konsultasi.
d. "evaluasi kesesuaian", seperti pada ISO 14001.
e. penyelidikan kejadian.
6. OHSAS 18001 sekarang mengacu sebagai standar, bukan spesifikasi atau dokumen
seperti pada edisi sebelumnya.
7. Definisi baru ditambahkan:
a. "insiden", "risiko", "penilaian risiko", dan definisi yang sudah ada
dirubah.
b. "risiko yang dapat ditolerir" menjadi "risiko yang dapat diterima".
definisi istilah "bahaya" tidak lagi mengacu kepada "kerusakan
properti atau kerusakan kepada lingkungan kerja".
"Kerusakan" tidak secara langsung berhubungan dengan manaje-
men kesehatan dan keselamatan kerja, melainkan termasuk da-
lam manajemen aset.
Secara ringkas, OHSAS 18001:2007 lebih kompatibel dengan ISO 14001:2004 dan ISO
9001:2000.
Periode transisi selama dua tahun
Organisasi yang telah mendapatkan sertifikat OHSAS 18001 memiliki masa transisi
selama dua tahun sampai dengan 1 Juli 2009. Organisasi sebaiknya segera menerapkan
peningkatan dan penyesuaian dan mendapatkan manfaat dari perubahan standar baru ini.
Perlu diperhatikan bahwa OHSAS 18001:2007 bukan merupakan obat yang dapat
menyelesaikan semua masalah kesehatan dan keselamatan kerja di suatu perusahaan,
namun merupakan cara yang baik yang diterima secara global dalam memperbaiki
lingkungan kerja dan peningkatan berkelanjutan melalui suatu sistem manajemen yang
terpadu.
OHSAS 18001 dapat diadopsi oleh setiap organisasi yang ingin menerapkan prosedur
formal untuk menurunkan tingkat risiko terkait kesehatan dan keselamatan kerja
karyawan, pelanggan dan umum.
Perbandingan OHSAS 18001:2007 dengan OHSAS 18001:1999

Battery Rebuilding Manual & Supplies for Reconditioning:

2009-03-09T16:25:00.000+07:00

The first thing that you must realize is that all batteries cannot be rebuilt. They must undergo a few simple tests to determine their present condition.
You will need some simple equipment and supplies in order to perform the required tests and to recondition the batteries:
1. A DC voltmeter.
2. An automotive battery load tester. It comes with full instructions from the manufacturer.
3. A battery Hydrometer.
4. A small electric drill.
5. A good quality battery charger.
6. A pair of homemade wire probes to clip to the test leads on your voltmeter. These are used to test each cell in the battery. They should be about eight inches long and can be made from brass brazing rod. This retards corrosion of the probes.
7. A plastic funnel to add the chemicals into each cell.
8. A supply of the China Depot battery treatment chemical to dissolve the buildup of sulfates in the bottom of the battery.
9. A stop drill bit to drill holes in the top of sealed batteries.
10. A supply of plastic plugs to seal the holes in the top of the batteries after repairs are completed. A good quality face shield to protect you eyes and face. NEVER WORK ON BATTERIES NEAR AN OPEN FLAME OR WHILE SMOKING. THE GAS FROM THE BATTERY CAN EXPLODE! ALSO, THE BATTERY ACID CAN BURN YOUR SKIN AND CLOTHING. Connecting cables to charge more than one battery at a time in parallel or in series if you have a series charger. Do not overload your charger.
This should cover your equipment and supply needs.
Now we will explain how to evaluate the battery for rebuilding or for scrap.

1. Place the battery on your test bench. Connect your load tester to the positive and negative terminals. The positive terminal is always the larger terminal and should have a + sign on it or next to it. DO NOT HOOK UP BACKWARDS AS YOU COULD DAMAGE THE LOAD TESTER. ALWAYS PUT THE POSITIVE LEAD ON FIRST AND REMOVE IT LAST TO AVOID DANGEROUS SPARKS.

2. Read the voltage shown on the load test meter. If the voltage is less than 12 volts chances are that the battery cannot be rebuilt. In the case of a six-volt battery it should read six volts. A battery that reads a volt less might bear further investigating. While the load tester is still hooked up you should perform a load test. Pressing the button on the tester and watching the needle does the test. Hold the button down for ten or fifteen seconds. If the needle drops like a rock and stays on zero the battery is probably junk. If the needle gradually climbs up to the yellow or green on the load test dial there is a good chance the battery can be rebuilt. Remember that each cell if it is working should read two volts. If the meter only reads ten volts total then you must have a dead cell. We don’t fix dead cells because we don’t take batteries apart.

3. One more set of tests that you can perform just to be sure is the cell test. We do two of them. One with a voltmeter and one with the battery hydrometer. If the battery has caps, pry them off. If it is sealed, drill the holes in the top of each cell with a stop drill so you won't hit the plates and damage them. Make sure all the cells have water covering the top of the plates. This could be the problem to start with.

4. Take the hydrometer and draw up the acid from the first cell. The scale that is marked on the hydrometer will tell you the condition of that cell. Make a note of the reading of that cell. Green is good, White is questionable and red is dead and probably will not come back with the treatment. Notice the color of the electrolyte while you are drawing the electrolyte from the cell. Draw it in and out several times so that you will disturb it and mix it up. This will give you a more accurate reading and also if the color is cloudy brown or black it means that the cell is in bad shape.

5. The voltmeter test is another very reliable test. Take the voltmeter and set in on the range that best reads out for twelve volts or six volts as the case may be. Clip the test leads onto each of the homemade brass probes.

a. Place the positive test lead on the positive terminal of the battery.

b. Stick the negative probe into the first cell next to the positive terminal. It should read approximately two volts. If it does not, record the voltage. Lower than two volts indicates a weak or bad cell.

c. Stick the negative probe into the second cell and stick the positive probe into the first cell that you just tested. Again, it should read approximately two volts. Record the voltage.

d. Follow this procedure right down the line to the last cell. REMEMBER THAT THERE IS ONLY A ZERO READING FROM THE LAST CELL TO THE NEGATIVE POST. Otherwise the total would be fourteen volts and not twelve. You have now pinpointed the low or dead cells in the battery.

e. If you consider the tests to indicate a marginal battery that might come back even though the test indicate it is junk you can perform the following procedure. Make sure all of the cells have water above the plates by at least one quarter of an inch. Add one tablespoon of the chemical reviver to each cell. Place the battery on the charger for one hour at a high rate of charge. Do not boil out the cells. After an hour you can then retest the low cells that you recorded. If they are reading two volts each you may then charge the battery at a low rate for at least twenty-four hours. It is more efficient to charge several batteries at one time on a low charge-using hook up cables. These may be obtained at an automotive supply store.

f. If the battery you are testing passes all of the tests you may then place it on the charger for a long slow charge. It is important to note that most of the batteries on the market today have lead calcium plates in them and when they get discharged down to a very low voltage they require a long slow recharge. YOU MUST ADD ONE TABLESPOON OF OUR CHINA DEPOT BATTERY TREATMENT CHEMICAL PURIFIER INTO EACH CELL TO DISSOLVE THE SULFATES THAT ARE BUILT UP ON THE PLATES.

g. After the battery has been on the low charger for twenty- four hours you should load test it and check the specific gravity of each cell with the hydrometer. All of the cells have to be in the green scale and the battery should load test no lower than the yellow scale on the load tester for a period of ten seconds. Follow the instructions furnished with your particular load tester.

h. The above procedures may seem complicated but they are not. You will learn them very quickly by experience. Do not be afraid to experiment with marginal batteries. Remember that you can load test them to be sure they are reliable and also, that you are giving your customer a twelve-month prorated warrantee on the unit. NEVER ARGUE WITH A CUSTOMER. GIVE HIM ANOTHER BATTERY OR GIVE HIM HIS MONEY BACK. Good customer service is the ONLY way to succeed in the long run; word gets around fast.

i. It is a good idea to save the electrolyte from the batteries that you junk. You may want to add some from time to time. This would be used in the case where you have a perfectly good battery but through someone's carelessness they wore a hole in it and you want to repair the hole and refill that cell. NEVER ADD ACID TO A BATTERY JUST TO SERVICE IT. YOU MIGHT BLOW IT UP! The best way to repair a hole in a battery is to use some fiberglass cloth and a two part epoxy resin repair kit. Just mix up the resin as per instructions and use it to glue several layers of the patch cloth over the hole. It is very important that you clean off the area around the hole with solvent that won't leave a residue (Denatured alcohol) and scratch up the case so the epoxy will stick better. Many a good battery has been saved with this procedure. Most of this is just common sense and always clean the rebuilt batteries with a mild solution of baking soda and water to neutralize the acid, and also clean up the terminals so that every battery looks as good as new.

A Realistic Definition Of Cycle Time

2009-03-08T14:24:00.000+07:00

CNC Tech Talk

By Mike Lynch

Many people determine cycle time by measuring cycle start to cycle start time. As the operator presses the cycle start button, he or she starts the stopwatch. The cycle runs and eventually the machine stops. The operator removes the workpiece and loads the next one. As the next cycle is activated, the stopwatch is stopped. The elapsed time on the stopwatch, which includes load/unload, is the cycle time.
While the cycle start to cycle start time is very important, it does not take into consideration those things that do not happen in every cycle. Say, for instance, that you have a 1,000-part production run and the cycle start to cycle start time is precisely three minutes. Will your production run be completed in 3,000 minutes? Unless you've already perfected cycle time reduction for your company, it probably won't. It's likely the actual production run will take much longer.
What causes the difference? There are probably many things the operator is doing that do not occur in every cycle, but these add to the length of time it takes to complete the production run. Tool maintenance, warm-ups, machine cleaning, offset adjustments and even personal time are but a few examples.
Here is a more realistic—though admittedly more difficult to predict—definition of cycle time. Cycle time is the amount of time it takes to complete a production run divided by the number of acceptable workpieces produced. For lack of a better term, we refer to this measure as the throughput time. If our 1,000-piece production run takes 5,000 minutes to complete, throughput time is five minutes.

Too many companies place great emphasis on reducing cycle start to cycle start time, but they pay little or no attention to throughput time. It's not uncommon, for instance, to reduce cycle start to cycle start time by getting more aggressive with speeds and feeds, greater depths of cut, and so on. But the additional tool maintenance time caused by these more aggressive cutting conditions is often overlooked. In reality, attempting to reduce cycle time in this manner may not provide the expected benefit. In fact, increasing cutting conditions to reduce cycle start to cycle start time may even increase the time it takes to complete the production run if tool maintenance must be done while the machine is down.

We urge you to compare cycle start to cycle start time with throughput time for a few of your longer running jobs. You may be very surprised at the difference. It's not a bad idea to document both times right in your CNC program. It is not uncommon to find that throughput time is at least 20 percent longer than cycle start to cycle start time. We've seen it over 50 percent longer!

When it comes to cycle time reduction, target reducing the difference between throughput time and cycle start to cycle start time is a primary goal. Minimize the impact of tool maintenance by moving it off-line (when the machine is not running) or by making maintenance as quick and easy as possible for the operator to perform. Be sure operators have all inserts and other cutting tool components at their fingertips. Be sure operators know they can be making offset adjustments for the purpose of holding size while the machine is running. Machine cleaning and warm-ups can be done while the machine is normally out of production, such as during lunch, breaks or off-shifts. As you study your own cycles and compare them to throughput time, you'll surely come up with ways to save time.

Visual Control

2009-02-23T14:47:00.000+07:00

The intent of a visual factory is that the whole workplace is set-up with signs, labels, color-coded markings, etc. such that anyone unfamiliar with the process can, in a matter of minutes, know what is going on, understand the process, and know what is being done correctly and what is out of place.
FACTS AND CONCEPTS
There are two types of application in visual factory: displays and controls.
A visual display relates information and data to employees in the area. For example, charts showing the monthly revenues of the company or a graphic depicting a certain type of quality issue that group members should be aware of.
A visual control is intended to actually control or guide the action of the group members. Examples of controls are readily apparent in society: stop signs, handicap parking signs, no smoking signs, etc.
This is in contrast to previous workplace rules, which dictated that performance data should be retained as "management secrets", for the sole consumption of managers who knew what do with the numbers.
Visual controls describe workplace safety, production throughput, material flow, quality metrics, or other information.
The most important benefit of a visual factory is that it shows when something is out of place or missing.
Visual displays and controls help keep things running as efficiently as they were designed to run. The efficient design of the production process that results from lean manufacturing application carries with it a set of assumptions. The process will be as successful as it was designed to be as long as the assumptions hold true. A factory with expansive visual display and control applications will allow employees to immediately know when one of the assumptions has not held true.
Audio signals in the factory are also very important because they signal malfunctioning equipment, sound warnings before the start of machine operation, or other useful information.
Visual management is an important support for cellular manufacturing. Visual management techniques express information in a way that can be understood quickly by everyone.
Sharing information through visual tools helps keep production running smoothly and safely. Shop floor teams are often involved in devising and implementing these tools through 5S and other improvement activities.
Visual information can also help prevent mistakes. Color coding is a form of visual display often used to prevent errors. Shaded "pie slices" on a dial gauge tell the viewer instantly when the needle is out of the safe range. Matching color marks is another approach that can help people use the right tool or assemble the right part.
EXAMPLES OF VISUAL APPLICATIONS
color-coded pipes and wires
painted floor areas for good stock, scrap, trash, etc.
shadow boards for parts and tools
indicator lights
workgroup display boards with charts, metrics, procedures, etc.
production status boards
direction of flow indicators

A BRIEF HISTORY OF LEAN MANUFACTURING

2009-02-22T15:04:00.000+07:00

U.S. manufacturers have always searched for efficiency strategies that help reduce costs, improve output, establish competitive position, and increase market share. Early process oriented, mass production manufacturing methods common before World War II shifted afterwards to the results-oriented, output-focused, production systems that control most of today's manufacturing businesses.

Japanese manufacturers re-building after the Second World War were facing declining human, material, and financial resources. The problems they faced in manufacturing were vastly different from their Western counterparts. These circumstances led to the development of new, lower cost, manufacturing practices. Early Japanese leaders such as the Toyota Motor Company's Eiji Toyoda, Taiichi Ohno, and Shingeo Shingo developed a disciplined, process-focused production system now known as the "Toyota Production System", or "lean production." The objective of this system was to minimize the consumption of resources that added no value to a product.

The "lean manufacturing" concept was popularized in American factories in large part by the Massachusetts Institute of Technology study of the movement from mass production toward production as described in The Machine That Changed the World, (Womack, Jones & Roos, 1990), which discussed the significant performance gap between Western and Japanese automotive industries. This book described the important elements accounting for superior performance as lean production. The term "lean" was used because Japanese business methods used less human effort, capital investment, floor space, materials, and time in all aspects of operations. The resulting competition among U.S. and Japanese automakers over the last 25 years has lead to the adoption of these principles within all U.S. manufacturing businesses.

WHAT IS LEAN MANUFACTURING?

Lean Manufacturing can be defined as:

"A systematic approach to identifying and eliminating waste (non-value-added activities) through continuous improvement by flowing the product at the pull of the customer in pursuit of perfection."

VALUE

In lean production, the value of a product is defined solely by the customer. The product must meet the customer's needs at both a specific time and price. The thousands of mundane and sophisticated things that manufacturers do to deliver a product are generally of little interest to customers. To view value from the eyes of the customer requires most companies to undergo comprehensive analysis of all their business processes. Identifying the value in lean production means to understand all the activities required to produce a specific product, and then to optimize the whole process from the view of the customer. This viewpoint is critically important because it helps identify activities that clearly add value, activities that add no value but cannot be avoided, and activities that add no value and can be avoided.

CONTINUOUS IMPROVEMENT

The transition to a lean environment does not occur overnight. A continuous improvement mentality is necessary to reach your company's goals. The term "continuous improvement" means incremental improvement of products, processes, or services over time, with the goal of reducing waste to improve workplace functionality, customer service, or product performance (Suzaki, 1987). Continuous improvement principles, as practiced by the most devoted manufacturers, result in astonishing improvements in performance that competitors find nearly impossible to achieve.

Lean production, applied correctly, results in the ability of an organization to learn. As in any organization, mistakes will always be made. However, mistakes are not usually repeated because this is a form of waste that the lean production philosophy and its methods seek to eliminate.

CUSTOMER FOCUS

A lean manufacturing enterprise thinks more about its customers than it does about running machines fast to absorb labor and overhead. Ensuring customer input and feedback assures quality and customer satisfaction, all of which support sales.

PERFECTION

The concept of perfection in lean production means that there are endless opportunities for improving the utilization of all types of assets. The systematic elimination of waste will reduce the costs of operating the extended enterprise and fulfills customer's desire for maximum value at the lowest price. While perfection may never be achieved, its pursuit is a goal worth striving for because it helps maintain constant vigilance against wasteful practices.

FOCUS ON WASTE

The aim of Lean Manufacturing is the elimination of waste in every area of production including customer relations, product design, supplier networks, and factory management. Its goal is to incorporate less human effort, less inventory, less time to develop products, and less space to become highly responsive to customer demand while producing top quality products in the most efficient and economical manner possible.

Essentially, a "waste" is anything that the customer is not willing to pay for. Typically the types of waste considered in a lean manufacturing system include:

Overproduction: to produce more than demanded or produce it before it is needed. It is visible as storage of material. It is the result of producing to speculative demand. Overproduction means making more than is required by the next process, making earlier than is required by the next process, or making faster than is required by the next process. Causes for overproduction waste include:

Just-in-case logic
Misuse of automation
Long process setup
Unlevel scheduling
Unbalanced work load
Over engineered
Redundant inspections

Waiting: for a machine to process should be eliminated. The principle is to maximize the utilization/efficiency of the worker instead of maximizing the utilization of the machines. Causes of waiting waste include:

Unbalanced work load
Unplanned maintenance
Long process set-up times
Misuses of automation
Upstream quality problems
Unlevel scheduling

Inventory or Work in Process (WIP): is material between operations due to large lot production or processes with long cycle times. Causes of excess inventory include:

Protecting the company from inefficiencies and unexpected problems
Product complexity
Unleveled scheduling
Poor market forecast
Unbalanced workload
Unreliable shipments by suppliers
Misunderstood communications
Reward systems

Processing waste: should be minimized by asking why a specific processing step is needed and why a specific product is produced. All unnecessary processing steps should be eliminated. Causes for processing waste include:

Product changes without process changes
Just-in-case logic
True customer requirements undefined
Over processing to accommodate downtime
Lack of communications
Redundant approvals
Extra copies/excessive information

Transportation: does not add any value to the product. Instead of improving the transportation, it should be minimized or eliminated (e.g. forming cells). Causes of transportation waste includes:

Poor plant layout
Poor understanding of the process flow for production
Large batch sizes, long lead times, and large storage areas

Motion: of the workers, machines, and transport (e.g. due to the inappropriate location of tools and parts) is waste. Instead of automating wasted motion, the operation itself should be improved. Causes of motion waste include:

Poor people/machine effectiveness
Inconsistent work methods
Unfavorable facility or cell layout
Poor workplace organization and housekeeping
Extra "busy" movements while waiting

Making defective products: is pure waste. Prevent the occurrence of defects instead of finding and repairing defects. Causes of processing waste include:

Weak process control
Poor quality
Unbalanced inventory level
Deficient planned maintenance
Inadequate education/training/work instructions
Product design
Customer needs not understood

Underutilizing people: not taking advantage of people's abilities. Causes of people waste include:

Old guard thinking, politics, the business culture
Poor hiring practices
Low or no investment in training
Low pay, high turnover strategy

Nearly every waste in the production process can fit into at least one of these categories. Those that understand the concept deeply view waste as the singular enemy that greatly limits business performance and threatens prosperity unless it is relentlessly eliminated over time. Lean manufacturing is an approach that eliminates waste by reducing costs in the overall production process, in operations within that process, and in the utilization of production labor. The focus is on making the entire process flow, not the improvement of one or more individual operations.

SOME BASIC ELEMENTS OF LEAN MANUFACTURING

Elimination of waste
Equipment reliability
Process capability
Continuous flow
Material flows one part at a time
Less inventory required throughout the production process, raw material, WIP, and finished goods
Defect reduction
Lead time reduction
Error proofing
Stop the Line quality system
Kanban systems
Standard work
Visual management
In station process control
Level production
Takt Time
Quick Changeover
Teamwork
Point of use storage

KEYS TO LEAN SUCCESS

Following are some considerations to successful lean implementation:

Prepare and motivate people

Widespread orientation to Continuous Improvement, quality, training and recruiting workers with appropriate skills
Create common understanding of need to change to lean

Employee involvement

Push decision making and system development down to the "lowest levels"
Trained and truly empowered people

Share information and manage expectations

Identify and empower champions, particularly operations managers

Remove roadblocks (i.e. people, layout, systems)
Make it both directive yet empowering

Atmosphere of experimentation

Tolerating mistakes, patience, etc.
Willingness to take risks

Installing "enlightened" and realistic performance measures, evaluation, and reward systems

Do away with rigid performance goals during implementation
Measure results and not number activities/events
Tie improvements, long term, to key macro level performance targets (i.e. inventory turns, quality, delivery, overall cost reductions)

The need to execute pilot projects prior to rolling culture out across the organization

After early wins in operations, extend across ENTIRE organization

TRADITIONAL VS LEAN MANUFACTURING

For years manufacturers have created products in anticipation of having a market for them. Operations have traditionally been driven by sales forecasts and firms tended to stockpile inventories in case they were needed. A key difference in Lean Manufacturing is that it is based on the concept that production can and should be driven by real customer demand. Instead of producing what you hope to sell, Lean Manufacturing can produce what your customer wants...with shorter lead times. Instead of pushing product to market, it's pulled there through a system that's set up to quickly respond to customer demand.

Lean organizations are capable of producing high-quality products economically in lower volumes and bringing them to market faster than mass producers. A lean organization can make twice as much product with twice the quality and half the time and space, at half the cost, with a fraction of the normal work-in-process inventory. Lean management is about operating the most efficient and effective organization possible, with the least cost and zero waste.

OVERALL ORGANIZATIONAL CHARACTERISTICS:

	TRADITIONAL MASS PRODUCTION	LEAN PRODUCTION
Business Strategy	Product-out strategy focused on exploiting economies of scale of stable product designs and non-unique technologies	Customer focused strategy focused on identifying and exploiting shifting competitive advantage.
Customer Satisfaction	Makes what engineers want in large quantities at statistically acceptable quality levels; dispose of unused inventory at sale prices	Makes what customers want with zero defect, when they want it, and only in the quantities they order
Leadership	Leadership by executive command	Leadership by vision and broad participation
Organization	Hierarchical structures that encourage following orders and discourage the flow of vital information that highlights defects, operator errors, equipment abnormalities, and organizational deficiencies.	Flat structures that encourage initiative and encourage the flow of vital information that highlights defects, operator errors, equipment abnormalities, and organizational deficiencies.
External Relations	Based on price	Based on long-term relationships
Information Management	Information-weak management based on abstract reports	Information-rich management based on visual control systems maintained by all employees
Cultural	Culture of loyalty and obedience, subculture of alienation and labor strife	Harmonious culture of involvement based on long-term development of human resources
Production	Large-scale machines, functional layout, minimal skills, long production runs, massive inventories	Human-scale machines, cell-type layout, multi-skilling, one-piece flow, zero inventories
Operational capability	Dumb tools that assume an extreme division of labor, the following of orders, and no problem solving skills	Smart tools that assume standardized work, strength in problem identification, hypothesis generation, and experimentation
Maintenance	Maintenance by maintenance specialists	Equipment management by production, maintenance and engineering
Engineering	"Isolated genius" model, with little input from customers and little respect for production realities.	Team-based model, with high input from customers and concurrent development of product and production process design

MANUFACTURING METHODS:

	TRADITIONAL MASS PRODUCTION	LEAN PRODUCTON
Production schedules are based on…	Forecast — product is pushed through the facility	Customer Order — product is pulled through the facility
Products manufactured to…	Replenish finished goods inventory	Fill customer orders (immediate shipments)
Production cycle times are…	Weeks/months	Hours/days
Manufacturing lot size quantities are…	Large, with large batches moving between operations; product is sent ahead of each operation	Small, and based on one-piece flow between operations
Plant and equipment layout is…	By department function	By product flow, using cells or lines for product families
Quality is assured…	Through lot sampling	100% at the production source
Workers are typically assigned…	One person per machine	With one person handling several machines
Worker empowerment is…	Low — little input into how operation is performed	High — has responsibility for identifying and implementing improvements
Inventory levels are…	High — large warehouse of finished goods, and central storeroom for in-process staging	Low — small amounts between operations, ship often
Inventory turns are…	Low — 6-9 turns pr year or less	High — 20+ turns per year
Flexibility in changing manufacturing schedules is…	Low — difficult to handle and adjust to	High — easy to adjust to and implement
Manufacturing costs are…	Rising and difficult to control	Stable/decreasing and under control

BENEFITS OF LEAN

All types of manufacturers are discovering the advantages of doing a Lean analysis and applying the principles of Lean Manufacturing to their own company. Perhaps you're faced with one, or many, of these challenges:

 Missed order dates

 High product cost relative to the competition

 Declining market share due to delivery time or cost problems

 Limited capacity

If so, Lean Manufacturing can have an immediate, positive impact on your company. Through the process of implementing Lean Manufacturing you will be able to find ways to achieve a number of benefits. Results will vary, but here are some typical savings and improvements:

Reduce:

Manufacturing Lead Time	50 - 90%

Floor Space Requirements	5 - 30 %
Work-in-Process	60 - 80%

Increase:

First-Pass Yields	50 - 100%
Throughput	40 - 80%
Productivity	75 - 125%

THE RELATIONSHIP OF WASTE TO PROFIT

Customer Focus
Waste Factor: Zero customer dissatisfaction/Relationship to Profit: Customer input and feedback assures quality. Customer satisfaction supports sales.

Leadership
Waste factor: Zero misalignment/Relationship to Profit: Direction and support for development improves cost, quality, and speed.

Lean Organization
Waste Factor: Zero bureaucracy/Relationship to Profit: Team-based operations reduce overhead by eliminating bureaucracy and ensuring information flow and cooperation.

Partnering
Waste Factor: Zero stakeholder dissatisfaction/Relationship to Profit: Flexible relationships with suppliers, distributors, and society improve quality, cost, and speed.

Information Architecture
Waste Factor: Zero lost information/Relationship to Profit: Knowledge required for operations is accurate and timely, thus improving quality, cost, and speed.

Culture of Improvement
Waste Factor: Zero wasted creativity/Relationship to Profit: Employee participation in eliminating operations waste improves cost, quality, and speed.

Lean Production
Waste Factor: Zero non-value-added work/Relationship to Profit: Total employee involvement and aggressive waste elimination promote speedier operations and eradicate inventories.

Lean Equipment Management
Waste Factor: Zero failures, zero defects/Relationship to Profit: Longer equipment life and design improvements reduce cost. Meticulous maintenance and equipment improvements increase quality. Absolute availability and efficiency increase speed.

Lean Engineering
Waste Factor: Zero lost opportunity/Relationship to Profit: Early resolutions of design problems with customers and suppliers significantly reduces cost, while improving quality and cycle time.

THE TRUE COSTS OF INVENTORY

Reducing inventory is an important goal of the lean organization. Carrying inventory has many costs associated with it. Obvious costs include: capital tied up in inventory and the associated loss of interest on that capita., loss due to material handling damage, increased labor costs for material handling, and increased space and storage requirement. A cost from excess inventory that is not so obvious is quality. In fact, many companies have seen quality improvements resulting from inventory reductions while not focusing on quality. The reasoning is that if an upstream process is producing parts on a machine and defects occur halfway through the batch, in an organization with low levels of inventory the next downstream process will discover the defects sooner. An organization with low inventory levels can stop the process when the defect is discovered, throw out the defective inventory, and request the previous process to start another batch. The organization with lower inventory levels will also be more effective at determining what caused the defect because the batch that the defect occurred in is fresh in the minds of both production and maintenance.

OTHER BENEFITS

 Reduced scrap and waste

 Reduced inventory costs

 Cross-trained employees

 Reduced cycle time

 Reduced obsolescence

 Lower space/facility requirements

 High quality & reliability

 Lower overall costs

 Self-directed work teams

 Lead time reduction

 Fast market response

 Longer machine life

 Improved customer communication

 Lower inventories

 Improved vendor support and quality

 Higher labor efficiency and quality

 Improved flexibility in reacting to changes

 Allows more strategic management focus

 Increased shipping and billing frequencies

Lean Glossary :

http://www.mamtc.com/lean/intro_glossary.asp

A

Andon Board: A visual control device in a production area, typically a lighted overhead display, giving the current status of the production system and alerting team members to emerging problems.

Autonomation: Automation with a human touch. Refers to semi-automatic processes where the operator and machine work together. Autonomation allows man-machine separation. Also referred to Jidoka.

B

Balanced production: All operations or cells produce at the same cycle time. In a balanced system, the cell cycle time is less than takt time.

Batch-and-Queue: Producing more than one piece of an item and then moving those items forward to the next operation before that are all actually needed there. Thus, items need to wait in a queue.

Benchmarking: The process of measuring products, services, and practices against those of leading companies.

Bottleneck: Any resource whose capacity is equal to, or less than the demand placed on it.

Best-in-Class: A best-known example of performance in a particular operation. One needs to define both the class and the operation to avoid using the term loosely.

Blitz: A blitz is a fast and focused process for improving some component of business a product line, a machine, or a process. It utilizes a cross-functional team of employees for a quick problem-solving exercise, where they focus on designing solutions to meet some well-defined goals.

C

Capacity Constraint Resources: Where a series of non-bottlenecks, based on the sequence in which they perform their jobs can act as a constraint.

Catch-Ball: A series of discussion between managers and their employees during which data, ideas, and analysis are thrown like a ball. This opens productive dialogue throughout the entire company.

Cells: The layout of machines of different types performing different operations in a tight sequence, typically in a U-shape, to permit single piece flow and flexible deployment of human effort.

Chaku-Chaku: A method of conducting single-piece flow, where the operator proceeds from machine to machine, taking the part from one machine and loading it into the next.

Change Agent: The catalytic force moving firms and value streams out of the world of inward-looking batch-and-queue.

Changeover: The installation of a new type of tool in a metal working machine, a different paint in a painting system, a new plastic resin and new mold in an injection molding machine, new software in a computer, and so on.

Constraint: Anything that limits a system from achieving higher performance, or throughput.

Continuous Flow Production: Means that items are produced and moved from one processing step to the next one piece at a time. Each process makes only the one piece that the next process needs, and the transfer batch size is one. Also called "single-piece flow" or "one-piece flow."

Covariance: The impact of one variable upon others in the same group.

Current State Map: Helps visualize the current production process and identify sources of waste.

Cycle Time: The time required to complete one cycle of an operation.

D

Dependent Events: Events that occur only after a previous event.

E

Error Proofing: Designing a potential failure or cause of failure out of a product or process.

F

Five S: Five terms utilized to create a workplace suited for visual control and lean production. Sort means to separate needed tools, parts, and instruction from unneeded materials and to remove the latter. Simplify means to neatly arrange and identify parts and tools for ease of use. Scrub means to conduct a cleanup campaign. Standardize means to conduct Sort, Simplify, and Scrub at frequent intervals to maintain a workplace in perfect condition. Sustain means to form the habit of always following the first Ss.

Flow: A main objective of the lean production effort, and one of the important concepts that passed directly from Henry Ford to Toyota. Ford recognized that, ideally, production should flow continuously all the way from raw material to the customer and envisioned realizing that ideal through a production system that acted as one long conveyor.

Functional Layout: The practice of grouping machines or activities by type of operation performed.

Future State Map: A blueprint for lean implementation. Your organization¹s vision, which forms the basis of your implementation plan by helping to design how the process should operate.

H

Heijunka: A method of leveling production at the final assembly line that makes just-in-time production possible. This involves averaging both the volume and sequence of different model types on a mixed-model production line.

Hosin Planning (HP): Also known as Management by Policy or Strategy Deployment. A means by which goals are established and measures are created to ensure progress toward those goals. HP keeps activities at all levels of the company aligned with its overarching strategic plans. HP typically begins with the "visioning process" which addresses the key questions: Where do you want to be in the future? How do want to get there? When do you want to achieve your goal? And who will be involved in achieving the goals? HP then systematically explodes the whats, whos and hows throughout the entire organization.

J

Just-in-Time (JIT): Principles that are fundamental to Time-Based Competition waste elimination, process simplification, set-up and batch-size reduction, parallel processing, and layout redesign are critical skills in every facet of the lean organization. JIT is a system for producing and delivering the right items at the right time, in the right amounts. The key elements of Just-in-Time are Flow, Pull, Standard Work, and Takt Time.

K

Kaizen: Continuous, incremental improvement of an activity to create more value with less waste. The term Kaizen Blitz refers to a team approach to quickly tear down and rebuild a process layout to function more efficiently.

Kanban: A signaling device that gives instruction for production or conveyance of items in a pull system. Can also be used to perform kaizen by reducing the number of Kanban in circulation, which highlights line problems.

L

Lead Time: The total time a customer must wait to receive a product after placing an order. When a scheduling and production system is running at or below capacity, lead time and throughput time are the same. When demand exceeds the capacity of a system, there is additional waiting time before the start of scheduling and production, and lead time exceeds throughput time.

Lean: Business processes requiring less human effort, capital investment, floor space, materials, and time in all aspects of operation.

M

Mistake Proofing: Any change to an operation that helps the operator reduce or eliminate mistakes.

Muda: Anything that interrupts the flow of products and services through the value stream and out to the customer is designated Muda or waste.

N

Non-Value Added: Activities or actions taken that add no real value to the product or service making such activities or action a form of waste.

O

Operating Expenses: The money required the system to convert inventory into throughput.

Overproduction: Producing more, sooner or faster than is required by the next process.

P

PDCA (Plan, Do, Check, Act)

 PLAN: Senior management should use the visioning process in the context of it Business Plan. HP translates the Business Plans to action plans, meaningful to all levels of the organization.

 DO: Answer the whats, hows, and whos for the total number of tiers for your organization; remember, the fewer the number of tiers, the better. Also, this is the time to bring management together and provide them with a basic understanding of HP mechanics.

 CHECK: On a periodic basis, review the measurements and note what you´ve learned that can help in the future.

 ACT: Make the necessary adjustments to plans and priorities in order to ensure the success of the strategy breakthroughs.

Perfection: Always optimizing value-added activities and eliminating waste.

Poka-Yoke: A mistake-proofing device or procedure to prevent a defect during order taking or manufacture. An order-taking example is a screen for order input developed from traditional ordering patterns that question orders falling outside the pattern. The suspect orders are then examined, often leading to the discovery of inputting errors or buying based on misinformation. A manufacturing example is a set of photocells in parts containers along an assembly line to prevent components from progressing to the next stage with missing parts. A poka-yoke is sometimes called a baka-yok.

Process: The flow of material in time and space. The accumulation of sub-processes or operations that transform material from raw material to finished product.

Process Kaizen: Improvements made at an individual process or in a specific area. Sometimes called "point kaizen".

Processing Time: The time a product is actually being worked on in a machine or work area.
PULL: A system of cascading production and delivery instructions from downstream to upstream activities in which the upstream supplier waits until the downstream customer signals a need. A pull system means producing only what has been consumed by downstream activities or customers.

Pull System: One of the 3 elements of JIT. In the pull systems, the downstream process takes the product they need and pulls it from the producer. This customers pull is a signal to the producer that the product is sold. The pull system links accurate information with the process to minimize waiting and overproduction.

Push System: In contrast to the pull system, product is pushed into a process, regardless of whether it is needed. The pushed product goes into inventory, and lacking a pull signal from the customer indicating that it has been bought, more of the same product could be overproduced and put in inventory.

Q

Quality Function Deployment (QFD): A visual decision-making procedure for multi-skilled project teams which develops a common understanding of the voice of the customer and a consensus on the final engineering specifications of the product that has the commitment of the entire team. QFD integrates the perspectives of team members from different disciplines, ensures that their efforts are focused on resolving key trade-offs in a consistent manner against measurable performance targets for the product, and deploys these decisions through successive levels of detail. The use of QFD eliminates expensive backflows and rework as projects near launch.

Quick Changeover: The ability to change tooling and fixtures rapidly (usually minutes), so multiple products can be run on the same machine.

Queue Time: The time a product spends in a line awaiting the next design, order processing, or fabrication step.

R

Reengineering: The engine that drives Time-Based Competition. To gain speed, firms must apply the principles of reengineering to rethink and redesign every process and move it closer to the customer.

Resource Utilization: Using a resource in a way that increases throughput.

S

Sensei: An outside master or teacher that assists in implementing lean practices.

Sequential Changeover: Also sequential set-up. When changeover times are within Takt time, changeovers can be performed one after another in a flow line. Sequential changeover assures that the lost time for each process in the line is minimized to one Takt beat. A set-up team or expert follows the operator, so that by the time the operator has made one round of the flow line (at Takt time), it has been completely changed over to the next product.

Seven wastes: Taiichi Ohno¹s original catalog of the wastes commonly found in physical production. These are overproduction ahead of demand, waiting for the next processing stop, unnecessary transport of materials, overprocessing of parts due to poor tool and product design, inventories more than the absolute minimum, unnecessary movement by employees during the course of their work, and production of defective parts.

Single Minute Exchange of Dies (SMED): A series of techniques designed for changeovers of production machinery in less than ten minutes. Obviously, the long-term objective is always Zero Setup, in which changeovers are instantaneous and do not interfere in any way with continuous flow.

Single-Piece Flow: A situation in which products proceed, one complete product at a time, through various operations in design, order taking, and production, without interruptions, backflows, or scrap.

Standards: These involve comparison with accepted norms, such as are set by regulatory bodies.

Standard Work: A precise description of each work activity specifying cycle time, takt time, the work sequence of specific tasks, and the minimum inventory of parts on hand needed to conduct the activity.

System Kaizen: Improvement aimed at an entire value stream.

Sub-Optimization: A condition where gains made in one activity are offset by losses in another activity or activities, created by the same actions crating gains in the first activity.

T

Takt Time: The available production time divided by the rate of customer demand. For example, if customers demand 240 widgets per day and the factory operations 480 minutes per day, takt time is two minutes; if customers want two new products designed per month, takt time is two weeks. Takt time sets the pace of production to match the rate of customer demand and becomes the heartbeat of any lean system.

Theory of Constraints: A lean management philosophy that stresses removal of constraints to increase throughput while decreasing inventory and operating expenses.

Throughput Time: The time required for a product to proceed from concept to launch, order to delivery, or raw materials into the hands of the customer. This includes both processing and queue time.

Total Productive Maintenance (TPM): A series of methods, originally pioneered to ensure that every machine in a production process is always able to perform its required tasks so that production is never interrupted.

V

Value: A capability provided to a customer at the right time at an appropriate price, as defined in each case by the customer.

Value-Added Analysis: With this activity, a process improvement team strips the process down to it essential elements. The team isolates the activities that in the eyes of the customer actually add value to the product or service. The remaining non-value adding activities ("waste" are targeted for extinction.

Value Chain: Activities outside of your organization that add value to your final product, such as the value adding activities of your suppliers.

Value Stream: The specific activities required to design, order and provide a specific product, from concept to launch, order to delivery, and raw materials into the hands of the customer.

Value Stream Mapping: Highlights the sources of waste and eliminates them by implementing a future state value stream that can become reality within a short time.

Visual Control: The placement in plain view of all tools, parts, production activities, and indicators of production system performance so everyone involved can understand the status of the system at a glance.

W

Waste: Anything that uses resources, but does not add real value to the product or service.

Work in Progress (WIP): Product or inventory in various stages of completion throughout the plant, from raw material to completed product.

Y

Yield: Produced product related to scheduled product.

What Are We Learning Since We Started Learning to See

2009-02-22T14:58:00.000+07:00

What Are We Learning Since We Started Learning to See?

By Mike Rother

The Learning to See workbook, which was first made public at the Lean Enterprise Institute's June 1998 Lean Summit in Hartford, CT, has surprised us all with its ongoing success. Learning to See has now sold over 85,000 copies in English, been translated into nine languages (most recently Spanish), won the 1999 Shingo Prize for research in manufacturing, and continues to garner acclaim as a guide for lean transformations.

At first glance, Learning to See is about a method and tool for analyzing and designing value streams, but our primary intent in writing the book was to help readers widen their perspectives from a limited focus on process-level improvement to include a view of the overall flow, or "value stream.” We designed the book's format with that objective in mind, and hope that it has indeed proved to be a perspective expander for you and your team.

The flow or value stream perspective represents a shift from vertical to horizontal thinking. Horizontal thinking means looking across the traditional vertical structures of functions and departments to connect activities in the stream of value flowing from suppliers, through the organization, and on to customers. In other words, concentrating on overall flow means focusing on system efficiency rather than on just the "point efficiency" of individual elements in your organization.

Building on Toyota’s Tool
In the last few years, a flow or value stream oriented manufacturing measurable has started climbing to the top of the heap: production lead time (or it's inversely-related sibling, inventory turns). One of the main goals of most production systems today is a continual reduction of lead time, which requires that processing steps in the value stream become more closely coupled to one another, allowing value to efficiently flow across them. Toyota's original flow mapping methodology — which we expanded into Value Stream Mapping — has provided us with an especially practical tool for thinking about flow and designing value streams with shorter lead times.

With all the interest and activity around value stream mapping it seems a good time to review how the value stream perspective and the mapping tool are developing, and some lessons we have learned along the way. That is the purpose of this article. I'd like to comment on some current issues, lessons learned and reader feedback relative to value stream mapping and value stream thinking.

I. New Developments and Issues in Value Stream Mapping

• The Paper Flow is Getting More Attention
When we say lead time, we are usually thinking about production lead time, which is the time it takes to go from raw material to shipment, or from "dock to dock.” However, another type of lead time measurement is the order lead time, or the time it takes to go from a customer order to delivery.

Figure 1: Production and Order Lead Times
(Note: in make-to-order value streams, the schedule point will be further upstream than is shown here.)

When you take a close look at the flow of a customer order through many organizations, it doesn't take long to see that a significant amount of the order lead time often occurs in administrative functions; before the order even reaches the shop floor. This is another value stream, which is being called the "administrative" or "service" or "white-collar" value stream. Here too, material (i.e. orders) sits in inventory (i.e. in-baskets) and doesn't flow. As long as an administrative process is truly necessary, then we should also apply horizontal thinking and perspective here in order to design administrative value streams with short lead times.

The value stream mapping tool presented in Learning to See is increasingly being applied to administrative flows. Of course, it often takes longer to personally trace a practically invisible administrative value stream, but that's how you have to do it, because you should not rely on statements like "this is how it normally goes.” Administrative processes are also usually more make-to-order in nature, and thus different from high-volume production processes. But these obstacles should not prevent you from getting started with flow analysis and improvement across administrative processes.

In addition to the order flow, there are, of course, several other administrative and support activities in an organization, such as processing engineering changes, maintenance, quality assurance, and so on. All of these can be analyzed and redesigned with the goal of shortening their lead times. However, in such other areas, which exist primarily to support or enable the production flow, there are two additional questions that you need to be asking:
Is this activity necessary?
How should this activity be conducted in order to support the shortest possible production lead time?
In other words, never forget that the value-adding production flow is the customer that these support functions should be serving.

• Readers are Expanding Their Value Stream View into Supply Chains
Once you have initiated flow and lead-time improvement inside the four walls of your facility, you can start expanding your view to include the supply chain. More and more users of value stream mapping are reporting successes in this area, and LEI's new workbook, Seeing the Whole by Dan Jones and Jim Womack, gives you more insight and suggestions on what some are calling "macro mapping."

At one level, value stream refers to the entire flow from raw materials coming out of the earth all the way through to the hands of the end consumer; and increasingly even beyond that to include recycling the product. However, if this is too much to tackle right now then I suggest you expand your one-facility view by going from the point of use at your customer's facility back through to the receiving dock at one or two of your most important suppliers. The discoveries of waste, batched information flow and interrupted material flow that you have made inside your own facility will repeat themselves there, and issues of location and transportation between facilities will become additional factors.

Although a single-piece flow across the supply chain is usually still a dream, closer-coupling concepts like pull systems between facilities and milk-run deliveries can be applied with dramatic results. Even at the supply-chain level the basic lean goal remains the same: How can we get ever nearer to having each process make (and, if necessary, the delivery truck pick up) only what the next process needs when it needs it?

• The "Pacemaker Process" Needs More Attention
A question that often arises is, "What should we focus on as we analyze and redesign our value streams?" There are a host of factors that affect lead time (take a look at pages 30-36 in Richard Schonberger's new book, Let's Fix It), but clearly the pacemaker process — which is often a final assembly process — is one that needs more of our attention. Many manufacturers don't recognize the pacemaker process' important role in attaining a short lead time through the value stream.

Today's in-plant value streams can often be divided into two segments: pacemaker and fabrication. Definitions:
The upstream fabrication processes respond to requirements from internal customers, and often utilize general-purpose or shared equipment to produce a variety of components for different downstream processes.
In contrast, the downstream portion of a value stream is often dedicated to a particular product family and responds to external customers. This segment typically starts at the value-adding process that is the schedule and leveling point in a lean value stream (see Learning to See p.86), and involves processing steps that give the product its final form for the customer. This downstream segment of the value stream is called the pacemaker.

Figure 2: Fabrication and Pacemaker Segments of a Value Stream

The pacemaker process influences production lead time because it is the rhythm-setting point, or "heartbeat," for the value stream. If the pacemaker makes large batches of one product type, or if it has significant fluctuations in production volume, then the upstream fabrication processes will have to hold more inventory to be able to meet the peaks of the pacemaker's jerky component requirements.

In addition, due to the "bullwhip" effect (which was first described by Jay W. Forrester in 1958) any mix or volume surges at the pacemaker get amplified as you move up the value stream and into the supply chain. The effects of pacemaker fluctuations get worse the further upstream you go! (The Seeing the Whole workbook has more information on how you can assess and reduce the effects of such demand amplification in your supply chains.)

Another problem: when the pacemaker makes large batches of one product type, then your external customers who want other types have to wait, or you will have to try to hold even more finished goods inventory of items that you think customers will want. (And correctly guessing what customers will want in the future is difficult to do.)

All of this means that the efficiency of your value stream depends partly on how small you can keep the volume fluctuations and batches at the pacemaker (assembly) process. Many plants are trying to link their chain of processes by establishing supermarket pull systems between processes. However, if you run significant volume fluctuations and/or large batches in assembly, then the inventory in those supermarkets will be too high. Result: with or without pull systems the lead time through the value stream will still be long. Leveled and mixed production at the pacemaker — a steady heartbeat — helps make shorter production lead time possible.

Think of the pacemaker process as the conductor of an orchestra. To achieve lean value streams, managers, production control, maintenance, supervisors and engineers will need to pay closer attention to how you are operating your pacemakers. (Please refer to LEI's Creating Continuous Flow workbook for detailed guidelines on setting up and running operator-based pacemaker process.)

As you may have guessed, the final assembly point in a macro value stream (across several facilities and companies) is the rhythm-setting pacemaker process to which the supply chain responds. The characteristics of the information flow emanating from this point will influence a how lean a whole upstream supply chain can be.

• Leaner Value Streams Will Require Faster Response to Problems
As the lead time through a value stream shrinks, the processes in that value stream become more "close coupled" (less buffer between them). This makes a value stream more sensitive to problems. When there is a machine breakdown, absenteeism, defective parts and so on in one segment of a lean value stream it will take less time before these problems adversely affect other segments. This is especially true of problems at the pacemaker process (see above).

As it more closely couples its value streams, industry will need to work more on a heretofore largely ignored aspect of Toyota-style manufacturing: The leaner a production chain gets, the greater the need for swift, local response to abnormalities. And swift response requires swift awareness of abnormalities, someone to do the responding and a structured approach for how to respond.

A critical issue here is how management thinks about production problems. If our vision is to ban problems from production (indicated by statements like, “We just need more discipline”), then we will organize and manage differently than if we assume that problems are going to occur. There seems to be a tacit belief that Toyota’s system means the occurrence of problems will be eliminated. Yet Toyota and its suppliers also experience quality problems, machine breakdowns, absenteeism, and so on. In fact, these types of problems are statistically guaranteed to occur. And as one problem is solved and its causes eliminated, others will develop. New product programs also bring new problems.

When management assumes that problems in production are inevitable, then the most important question becomes, “How will we respond to them?” This is going to become a particularly important question for any company that is seriously trying to adopt lean production, since the faster you can successfully respond to abnormalities, the leaner you can make your value stream.

II. Notes and Advice From the Field

Learning to See has been very successful, but at the same time any book is subject to various interpretations by its readers. Here are some that we have observed as we visit and work with many companies.

• Some readers of Learning to See appear to think that value stream mapping is in itself a goal, occasionally telling us, "We are drawing maps of all our value streams!" That may lead to a better understanding of your flows, but not necessarily to any measurable improvement. Think of mapping as a method and tool to assist you in making flow improvements. The more important goal is active implementation of an improved future state.

Instead of mapping everything and expecting good things to happen as a result, we suggest you, 1) select a value stream where business objectives require measurable improvement, 2) develop an understanding of the current state, 3) design and agree upon an improved future state that can be introduced within six or 12 months, 4) put together an action plan to implement that vision (who is responsible for achieving what elements of the vision with what measurable results by when?). And in 12 months, you need to create the next future state map for that value stream and again charter a team to achieve that future state.

• We would also like to mention that having a perfectly drawn current state map is not the initial focus of VSM. A main intention of current state mapping is the process of understanding the dock-to-dock flow — the looking and sketching and trying to see and comprehend what is happening — and thinking about what should be happening — as material and information travel through your facility (or supply chain). Have you noticed that the person who best understands the material and information flows that a value stream map represents is the person who drew the map? The map creation process —more than just the map itself — helps you learn to see.

This is why we suggest that you begin sketching with just pencil and paper as you walk a flow. The looking, sketching and resketching may seem like a lot of manual work, but it is in fact a PDCA (Plan, Do, Check, Act) learning cycle that keeps you focused on the flow and deepens your understanding of the production system. With practice, you may be surprised at how quickly you can pretty accurately sketch dock-to-dock material and information flows. In other words, how quickly you can see. Then you are in a better position to develop useful future state value stream designs.

• There has occasionally been a mix-up between value stream mapping and traditional process flow charting, which is typically used by industrial engineers to analyze and improve a process. Value stream mapping (and design) cuts across process, departmental and functional boundaries, as well as across existing departmental performance-measurement systems. It involves trying to optimize dock-to dock flow instead of an individual process.

Since the value stream cuts across boundaries it means that top manufacturing management should be leading the value stream improvement effort. Although they may not necessarily do the mapping themselves, manufacturing executives and managers should be able to read a future-state value stream map and know what questions to ask.

• Some readers have focused intently on counting and tallying inventory, and using that data to estimate the production lead time as described in Learning to See. Lead time is a great metric and we recommend that you focus on reducing it. (Note: Outsourcing lead time does not equal reducing it.) However, don't let the activity of counting inventory become more important than the fundamentals of seeing and understanding the flow (or lack of flow) through your value streams.

Inventory tells you where a flow is interrupted. Once you have found these spots in your value stream then the next questions are, "Why does the flow stop here?" (there is always a reason), and, "What can we do to improve this situation?"

• Sometimes readers find it difficult to stay at the 100 ft.-level altitude the first few times they map a value stream to understand the current state. After years of making process-level improvements, you may naturally tend to drop to a very detailed level of analysis at every process along the way; trying to record all sorts of current-state process data up front. This especially seems to happen when you walk the flow through your own, familiar facility. Unfortunately, you then tend to lose the valuable overall flow perspective that Learning to See is all about.

My suggestion? Begin with the main or most important dock-to-dock branches of your value stream, and walk through them at a "100 ft. altitude.” Then go back and progressively drop down to add detail or additional branches on successive walk-throughs as is necessary to support your design and implementation of a future state. The first walk-through may only take an hour and result in only a rough current-state sketch.

The mapping process is not linear, although our presentation of it in Learning to See might lead you to believe that. You don’t really finish a current state map (“done!”), then finish a future state map (“done!”) and then shift to implementation. There is considerable overlap and feedback between these stages, and you should expect to have to periodically go back and gather more data as you realize you need it.

• We've noticed some readers going too far out into the future with their initial future state designs. Such future states are nice in theory, but about as difficult to achieve as a home run. Introducing Toyota-style production can't be done overnight, and involves steady progress via lots of base hits.

If you have drawn more than, say, six kaizen lightning bursts on a future state map, you are probably reaching too far out into the future with that map.

A suggestion is to draw one sketch of where you would like to be in about 5 years — we call this an "ideal state map" — and another, more detailed "future state map" of what you and your team can agree to have implemented within a maximum of 12 months time. Then as you work on implementing the 12-month future state you should be learning things and can fine tune your "ideal state" vision. At the end of 12 months it is time to have another 12-month map and implementation plan.

III. Reader Feedback

Our publisher, the Lean Enterprise Institute, has been open to comments and feedback from its community of readers. In addition to much positive feedback we have also received ideas and suggestions for improvements and additions to the Learning to See book, and were able to incorporate several of them in the current edition of Learning to See. There are also a handful of items that we have not added, such as:
More end-item variety to the Acme Stamping case.
Examples from different industries.
VSM in non-production settings. ("Administrative" or "white-collar" mapping.)
Detailed guidelines for managing the implementation of a future state value stream vision.
Tips for mapping across multiple facilities and organizations. ("Supply chain" or "macro" mapping.)
How to set up and run the pacemaker process.
Dealing with changing demand.
Calculating the financial benefits of a future-state design.
These — and probably more — could all be useful additions to Learning to See. But then by far the most frequent feedback of all is that the book is wonderfully straightforward, clear, and easy to understand and use. Readers are able to absorb the book and get started with positive action in their own facilities, and in many cases train others (sometimes using LEI's Training to See kit) in value stream mapping.

This makes us hesitant to complicate Learning to See with a string of detailed appendices in an attempt to make the book completely authoritative. Like any book, Learning to See reflects a need and some thinking at a point in time. The intent is to provide a springboard for seeing and thinking about your own value streams. Learning to See says what it says, does what it does, and we are pretty happy with that. You must be too, because demand for the book is still growing.

In fact, the amount of positive action, experimentation and dialog that is being triggered in part by Learning to See has been terrific. Many people are working on all manner of problems related to removing waste from their value streams. Follow-on books are being published at the Lean Enterprise Institute (such as Creating Continuous Flow, Seeing the Whole, Learning to Count), workshops are focusing on "value stream" and "value stream management," and elements of the simple (but surprisingly effective) Acme Stamping case from Learning to See keep popping up everywhere.

So Learning to See continues to serve as the fundamental value stream book, while supplements to it are being created in an even better fashion than just a couple of authors might do. Many more people are working on the issues, via several channels and with interesting perspectives.

Of course, successful implementation is what really counts. So, our hats go off to all who are rolling up their sleeves and advancing the war on waste through implementation that generates shorter lead times and positive results for customers. Keep on looking and thinking — and seeing — with a value stream perspective.

With best regards,

Mike Rother

Mike Rother is the co-author of LEI's Learning to See and Creating Continuous Flow books, as well as the Training to See training kit. He is a teacher at the University of Michigan and a manufacturing consultant based in Ann Arbor, Michigan. Mike recently returned to Ann Arbor after spending a year as guest researcher at the Fraunhofer Institute for Production Technology in Stuttgart, Germany.
Copyright © March 2002, by Mike Rother

Develop skills to eliminate waste

2009-02-22T14:44:00.000+07:00

Develop skills to eliminate waste!

According to the 1999-2001 Management Issues Survey conducted by the Alliance of Manufacturers & Exporters Canada, the most commonly reported techniques used by companies to overcome barriers to quality advancements are "change in organization culture" and "upgrading employee skill sets." How are they accomplishing this?
Many companies are teaching and using the tools of Lean Manufacturing to accomplish both goals. But that’s only the beginning. Now, how do we eliminate that waste and get lean? Let’s look at some tools that get you along the road from traditional to lean— "5S", Pull Systems, Setup reduction, Poka Yoke and Standard Work.
"5S"… It’s more than housekeeping!
Sort, straighten, sweep, standardize, sustain — This sequence of suggested steps solves some sticky situations to set up a system! Based on a Japanese model, which translates to these ‘5S’s, the workplace is transformed and organized.
Sort
Get rid of the clutter. Remove items that are not frequently used, so we can find the things we do need.
Straighten
"A place for everything and everything in it’s place" makes it ready to use, easy to find and close to the point of use. Use labels, colour-coding and shadow-boards so tools and materials stay where they belong.
Sweep
Get rid of the dust, oil and grime. Find the "dirt", plug the leaks and install collection systems to keep it clean.
Standardize
Develop procedures to maintain workplace organization. Assign responsibilities, integrate duties into regular work and audit performance on a regular basis.
Sustain
Make it an ongoing management priority to support the system that the team has worked to create.
Pull systems
The traditional "push" system kept people and machines busy. We asked them to "push" the product along the production line to the next operation. Sounds logical, right? But, what happens to the production not yet needed by either an internal or external customer? Waste is born.
As inventory is created, so too is the risk of obsolescence, quality defects and handling damage. The solution lies in a "pull" system where the customer, either internal or external, controls what is produced. We make only what is necessary, when it is necessary.
How does it work? Simple… a signal commands that production make only what is required. The signal to produce is called a "Kanban" and it may be an empty square marked on the floor, an empty shelf, a card describing the parts required, or an electronic signal. "What" it is doesn’t matter but, it can’t work without a Kanban!
No signal = no production.
Signal = produce exactly what is asked for, no more, no less, and make it right the first time.
Keep the setup down!
The traditional plant controlled the impact of changeover time by cranking up production to keep it rolling as long as possible, resulting in fewer setups and large batches. A lean plant however, attacks the issue from within by viewing setup time as a process that can be improved. How?
1.Analyze all the steps taken to change from one product to the next. A video camera is usually the fastest, easiest and most accurate way to record the procedure for analysis.
2.Classify the steps as internal —done while the operation is stopped, or external — done while the operation is running.
3.Establish a new setup procedure.

Tips and Tricks
Keep these in mind as you establish your new setup procedures…
Convert as many internal steps as possible to external.
Eliminate adjustments.
Use quick connects.
Minimize travel distance.
Make sure tools are handy and easy to find.
Practice! Follow the example of a pit crew at the race track.

Poka Yoke — The answer to Murphy’s Law!
Poka Yoke is a Japanese term for an error-proofing device.
Murphy’s Law implies that
If two parts can be assembled wrong, they will be assembled wrong. If two different parts look almost the same and could be mixed up, they will be mixed up. If the procedure is too complex, it will not be followed. If the instructions are confusing, they will be misinterpreted."
Sound familiar? Poka Yoke contends that Murphy doesn’t need to rule! Planning and procedures make the difference…
Design parts or fixtures to prevent incorrect assembly.
Design parts so they won’t be confused.
Use colour coding.
Use simple checklists, clear instructions, and easy-to-use forms.
Install sensors to stop machines if defects occur.
Standard work — not 50 recipes, just one!
AMEC’s 1999-2001 Management Issues Survey reported that the top area within business to receive improvement from quality systems was operational efficiency. This makes sense when we consider that part of what a good quality system does is to establish standard practices and work instructions. The days of each operator or shift doing it "their way" can not continue. "Standard Work" is defined as, the way we all agree to do it today. With continuous improvement we may change the process, but we must all agree to the change. Only then can we determine the extent to which the change has proved effective.
In the Lean or Kaizen sense, Standard Work has 3 components;
Take Time: The time required to produce one unit in order to exactly match customer demand over a specified time period. The production line, or the sequence of operations required to produce our product, must be balanced so that each operation matches the takt time. It is the "beat" or rhythm of the plant.
Work Sequence: The definition of the order and timing of the steps performed by operators to produce the output of our process. It is a standard practice to be followed by all operators.
Standard WIP: The definition of the Work-in-Process between each operation. Our Pull system will maintain this inventory at a constant level. Initially we may need some WIP to protect bottleneck operations, but ideally work will move one piece at-a-time with no queues between operations.
Take those tools and do it!
These five tools can move a traditional production plant along the road to lean regardless of size. The premise is rooted in logic - use the tools, eliminate waste and stay competitive!

EMPLOYEE EMPOWERMENT

2009-02-22T14:39:00.000+07:00

EMPLOYEE EMPOWERMENT: A CRUCIAL INGREDIENT IN A TOTAL QUALITY MANAGEMENT STRATEGY.

1. Quality starts with People.

A sound total quality management (TQM) implementation process should be concerned with more than just the mechanical aspects of the change. Instead, it should focus on improving the more indirect value characteristics of the organization such as trust, responsibility, participation, harmony and group affiliation. Empowerment, the most important concept in TQM, is many things, since employees must be empowered to make the necessary organizational changes (Stevens, 1993). The concept of empowerment is based upon the belief that employees needs the organization as much as the organization needs them and that leaders understand that employees are the most valuable asset in the firm.

2. Participative management- more than a management buzzword.

Participative management has become a key word in empowerment. Research has shown that there is a positive link between participation and satisfaction, motivation and performance (Holander, Offerman, 1990: 183). "The self-managed work team is a new way of viewing the relationship of the worker-management-organization" (Keighley,1993: 6). Employee involvement teams, which consists of small groups of employees who work on solving specific problems related to quality and productivity represent one way of particpatitve management. Such teams have proved effective in resolving problems related to productivity and quality, as well as improved employee morale and job satisfaction (Bartol, Martin, 1991: 650).

Whatever the definition is, participative management requires responsibility and thrust to employees. It is important that management recognizes the potential of employees to identify and to derive corrective actions to quality problems (Stevens, 1993: 20). However, according to Stevens (1993: 20), if management refuses to act upon team recommendations, "the team members' faith in the quality program will be destroyed."

Furthermore, critics argue that employees may be given the impression that TQM and employee empowerment is just another management buzzword, and that the decision making process is still dominated at the top of the organizational hierarchy (Scully, 1993: 453). In many organizations, this traditional labor division is the principal cause why managers finds it difficult to delegate responsibility. Scully (1993: 455) also argues that to some people empowerment means more delegation in form of indirect control. Moreover, Stevens (1993: 18) stresses that some subordinates may view empowerment as abandonment and that it leads to organizational anarchy.

3. "We are all in it together."(Bluestone, 1992: 34)

"Workers affected by proposed changes must be involved in the decision to change, else they will fight progress" (Magjuka, 1993: 63). In an empowered organization, people should not expect to be told what to do, but they should know what to do. The primary role of management is "to support and stimulate their people, co-operate to overcome cross functional barriers, and work to eliminate fear within their own team" (Hand, 1994: 25).

However, many supervisors think that empowerment may lead to them loosing authority and ultimately their jobs. Therefore, it is logical that most of the resistance to empowerment comes from the middle management (Keighley, 1993: 7). Keighley argues that this resistance to change can be reduced by setting, measuring and evaluating performance together with the team (1993: 8). Likewise, Hand argues that supervisors and managers should be trained in order to cope with organizational change (1994: 24).

In addition, managers argue that employees are unable to get the whole picture of the organization, and that they are not all qualified to make decisions. Dobbs (1993: 55) argues that work-teams are unable to see the connection between process improvements and the overall strategy and profitability of the firm.

4. Empower from the "bottom up".

The most important concept of empowerment is to delegate responsibility to the lowest levels in the organization. The decision making process should be to a high degree decentralized and individuals or work designed teams should be responsible for a complete part of work processes (Lawler, 1994: 70).

For instance, Saturn, a highly successful American car manufacturer, empowered its employees by turning assembly lines into dedicated process oriented work stations solely managed by the work team. Even the design process involves a high degree of employee participation. In the Saturn case, empowerment became directly linked to responsibility, and employees make suggestions how to improve processes (Bluestone,1992:38). Stevens suggests that "the ultimate success of a quality program is based on its ownership by employees and their empowerment to make changes" (1993: 20). It is crucially important that management value employee suggestions and manage accordingly. Naturally, workers directly involved in a process knows best how to improve it (McMillan, Mahoney. 1994: 177). In an Empowered organization, employees feel responsible beyond their own job, since they feel the responsibility to make the whole organization work better.

Lawler (1994: 71) does to a certain extent oppose the ideas mentioned in this section. He argues that employee empowerment does not directly constitute to the success of a TQM program since quality is always on the center stage in such a strategy. Opposite to this, employee empowerment is usually the result of an organization's strategy and technology, focusing not only on how to improve cost, speed, and efficiency through quality improvements (Lawler, 1994: 71).

5. Employees- The most important asset in organizations.

Empowered personnel have "responsibility, a sense of ownership, satisfaction in accomplishments, power over what and how things are done, recognition for their ideas, and the knowledge that they are important to the organization" (Turney 1993: 30). Without productive employees, the organization is nothing and can do nothing. Empowerment works the best when employees need their organization as much as the organization needs them, "and the need is much more than a paycheck and benefit package" (Johnson, 1993: 47).

Johnson (1993: 47) is aware that there is a belief that employees only work to get monetarily compensated. However he argues that it is only true when employees are not able to play an integral part of the organization. Likewise, Mahoney, McMillan (1994) propose that the empowerment process is only successful when there is room for feedback and autonomy in the organizational culture. Only in such a scenario, it is possible to fully utilize the capabilities of your employees. The golden rule is that "leaders have to treat their employees the way they want the bosses to treat them" (Johnson, 1993: 47).

6. Treat Your employees the way you want your customers to be treated.

The most crucial critical success factor in TQM is to recognize the importance of living up to customers expectations (Johnson, 1993: 47). It is important to understand that there is a positive correlation between satisfying internal customers and meeting external customers needs. "Employees who are not treated correctly cannot be expected to treat external customers differently" (Johnson, 1993: 47). Internal satisfaction can be achieved in the following ways: establish a high degree of participative management, decentralization of hierarchy power structures, create a large degree of autonomy throughout the organization and finally the development of effective work groups. All these ways are based on the concept of employee empowerment.

7. Conclusion.

Employee empowerment is more than a management buzzword and a text-book definition. It is a new way of managing organizations towards a more complex and competitive future. A TQM strategy is deemed to fail if empowerment of employees is absent. Quality starts with engaging the people responsible for processes- the people who know the processes the best. The people whom critics argue are unable to understand the holistic aspects of the organization. However, partcipative management has proven very successful in fostering responsibility, motivation and belongingness in organizations with high autonomy and flexibility.

REFERENCE LIST:

Bartol, K.M. and Martin, D.C. (1991). Management. New York, McGraw-Hill

Bluestone, Barry, Bluestone, Irving. (1992). "Workers (and Managers) of the World Unite." Technology Review. November/December: 31-40

Dobbs, John H. (1993). "The empowerment environment." Training and Development. February: 55-57

Hand, Max. (1994). "Freeing the victims." Personnel Review. February: 20-25

Hollander, Edwin P. Offerman, Lynn R. (1990). "Power and Leadership in Organizations." American Psychologist February: 179-188

Johnson, Richard S. (1993). "TQM: Leadership for the Quality Transformation." Quality Progress April: 47-49

Keighley, Trevor. (1993). "Creating an empowered organization." Training and Development in Australia. December: 6-11

Lawler, Edward E. (1994). "Total Quality Management and employee involvement: Are they compatible?" Academy of Management Executive January: 68-76

Magjuka, Richard J. (1993). "The 10 Dimensions of Employee Involvement." Training & Development April: 61-67

Mahoney, Patricia L, McMillan, Alan. (1994). "Riding the Quality Horse." Occupational Hazards October: 177-178

Scully, John. P. (1993). "A point of view: Actions speak louder than buzzwords." National Productivity Review (NLP) Autumn: 453-456

Stevens, David P. (1993). "Avoiding failure with total quality." Quality (QUA). December: 18-22

Turney, Peter B.B. (1993). "Beyond TQM With Workforce Activity Based Management." Management Accounting September: 28-31

Zero Quality Control

2009-02-22T08:33:00.000+07:00

In traditional manufacturing environments, quality inspections usually occur at receipt of goods and through sampling after a product's final assembly. In lean manufacturing environments, inspection (and product rework) are accommodated at any point in a product's life, as it is being produced.
FACTS AND CONCEPTS
This is accomplished by determining equipment (or other manufacturing) parameters that produce good parts, then rigorously monitoring and adjusting each operation to meet these parameters.
Employees are empowered to stop the equipment (or the equipment is built to stop on its own) when the process drifts outside the parameter limits.
Often combined with this is a program to error-proof each manufacturing step (called Poka-Yoke). This involves equipping machines or workstations with devices to assure that parts can only be made the correct way.
ZERO QUALITY CONTROL
Product defects hurt the company's reputation with its customers and waste valuable resources in scrap and rework. Companies that pursue low-inventory production no longer have a large buffer to absorb quality defects. To keep production moving smoothly, it is especially important to prevent defects
Mistake proofing is an effective quality assurance approach that prevents defects by catching errors and other nonstandard conditions before they actually turn into defects. The mistake-proofing system known as Zero Quality Control ensures zero defects by inspecting the processing conditions for 100 percent of the work, ideally just before an operation is performed. If an error is discovered, the process shuts down and gives immediate feedback with lights, warning sounds, and so on.
Zero Quality Control Elements
Source inspection to catch errors before they become defects
100 percent inspection to check every workpiece, not just a sample
Immediate feedback to shorten the time for corrective action
Poka-yoke (mistake-proofing) devices to check automatically for abnormalities
POKA-YOKE
Because people can make mistakes even in inspection, mistake-proofing often relies on sensing mechanisms called Poka-Yoke, which check conditions automatically and signal when problems occur. Poka-Yoke devices include electronic sensors such as limit switches and photoelectric eyes, as well as passive devices such a positioning pins that prevent backward insertion of a workpiece. Poka-Yoke devices may use counters to make sure an operation is repeated the correct number of times.
The key to effective mistake-proofing is determining when and where defect-causing conditions arise and then figuring out how to detect or prevent these conditions, every time. Shop floor people have important knowledge and ideas to share for developing and implementing poka-yoke systems that check every item and give immediate feedback about the problem.

SSC AERO EV

2009-02-16T08:12:00.000+07:00

SSC Announces Electric Powertrain and Ultimate Aero EV Specifications

WEST RICHLAND, WA (01/22/2009)

2009 SSC Ultimate Aero EV

Shelby SuperCars (SSC) released today the details of its revolutionary All-Electric Scalable Powertrain, the AESP. SSC will incorporate its AESP into thecurrent Ultimate Aero to create the Ultimate Aero EV. Being the "World's Fastest Production Car," SSC decided the Ultimate Aero to be the perfect high visibility outlet to demonstrate the capabilities of its new Green powertrain. Directly following the debut of the Ultimate Aero EV, SSC will conduct a live media event to showcase the capabilities of its revolutionary Green powertrain.

SSC will display its AESP in the Ultimate Aero EV in order to prove that electric-powered vehicles will not only match but also provide more linear power (electric motors have 100% torque at 0 RPM) and overall performance than internal combustion cars. The Ultimate Aero EV utilizes a twin motor AESP producing an astounding 1,000 HP and 800 lb-ft of torque enabling it to rocket to 60 mph in a mere 2.5 seconds and reach a top speed of 208 mph. Not only does the Ultimate Aero EV have a range of 150-200 miles on a single charge, but SSC's "Charge on the RunTM" onboard charging system allows for full battery recharges in as little as 10 minutes. SSC's 3-speed automatic transmission transfers the Ultimate Aero EV's power to its wheels and achieves electronically controlled shift times of .24 s. The entire AESP is liquid cooled allowing it to run for extended periods of time at peak performance with no overheating issues.

SSC's Green division, SSC Green, Inc., will provide packaged solutions of its AESP to a wide variety of applications ranging from 200 horsepower for economy and midsize cars, to 500 horsepower for light trucks and SUVs, and up to 1,200 horsepower for delivery trucks, heavy-duty equipment, buses and military vehicles.

SSC expects to roll out its first full-scale, pre-production Ultimate Aero EV in second quarter 2009. Ultimate Aero EV deliveries will start as early as fourth quarter 2009. SSC will pursue the title of "World's Fastest Production Electric Car" and conduct a marketing campaign consisting of international motor shows, magazine articles, TV appearances and live media events. Most importantly, SSC will conduct a live media event at one of America's superspeedways to prove its claims. During this event SSC Founder and Lead Designer, Jerod Shelby, and notable guests will drive laps at high speed pitting only to demonstrate the quick recharge times. SSC asks any interested media to send a request to AeroEVMedia@sscautos.com.

TUTORIAL GADGET BLOG

2009-02-15T14:44:00.000+07:00

Aki Bekas

2009-02-01T10:59:00.000+07:00

Aki bekas, Accu Bekas, atau di kenal dengan istilah secondary lead acid battery tergolong limbah B3.
Aki bekas biasanya di manfaatkan kembali atau di proses kembali (recycle) untuk diambil timahnya, kandungan timah untuk Aki bekas sebanyak +/- 65 % dari berat netto aki bekas bila di proses dengan menggunakan rotary furnace, apabila di proses dengan menggunakan metode tradisional hanya di dapat 55 %.
Timah hitam (Lead) yang didapat dari proses pembakaran biasanya tidak murni 99.99 % (soft lead) tetapi fluktuatif di kisaran 90 % hingga 97 % di karenakan terdapat kandungan lain di dalamnya yaitu Sb, Sn, Se, As, Dll. Timah hitam (Lead) hasil proses sederhana ini di sebut timah banci/timah lokal.
biasanya untuk mendapatkan hasil yang lebih baik di gunakan coustic soda pada saat proses pembakaran.

Total Productive Maintenance

2009-01-17T08:34:00.000+07:00

7 Wastes of Production

2009-01-16T14:26:00.000+07:00

7 Wastes of Production

Taiichi Ohno defined the 7 types of waste that describe all activity that adds cost but not value. In a Lean Enterprise these 7 types of “Muda” are the target of an endless pursuit of waste elimination. Learning to see “Muda” all around you is the key to starting out on your journey of transforming your organization into a Lean Enterprise.

The 7 Wastes – “Muda”	Definition	Examples	Causes	Countermeasures
Overproduction	Producing more than the customer needs right now	Producing product to stock based on sales forecasts Producing more to avoid set-ups Batch process resulting in extra output	Forecasting Long set-ups “Just in case” for breakdowns	Pull system scheduling Heijunka – level loading Set-up reduction TPM
Transportation	Movement of product that does not add value	Moving parts in and out of storage Moving material from one workstation to another	Batch production Push production Storage Functional layout	Flow lines Pull system Value Stream organizations Kanban
Motion	Movement of people that does not add value	Searching for parts, tools, prints, etc. Sorting through materials Reaching for tools Lifting boxes of parts	Workplace disorganization Missing items Poor workstation design Unsafe work area	5S Point of Use Storage Water Spider One-piece flow Workstation design
Waiting	Idle time created when material, information, people, or equipment is not ready	Waiting for parts Waiting for prints Waiting for inspection Waiting for machines Waiting for information Waiting for machine repair	Push production Work imbalance Centralized inspection Order entry delays Lack of priority Lack of communication	Downstream pull Takt time production In-process gauging Jidoka Office Kaizen TPM
Processing	Effort that adds no value from the customer’s viewpoint	Multiple cleaning of parts Paperwork Over-tight tolerances Awkward tool or part design	Delay between processing Push system Customer voice not understood Designs “thrown over the wall”	Flow lines One-piece pull Office Kaizen 3P Lean Design
Inventory	More materials, parts, or products on hand than the customer needs right now	Raw materials Work in process Finished goods Consumable supplies Purchased components	Supplier lead-times Lack of flow Long set-ups Long lead-times Paperwork in process Lack of ordering procedure	External kanban Supplier development One-piece flow lines Set-up reduction Internal kanban
Defects	Work that contains errors, rework, mistakes or lacks something necessary	Scrap Rework Defects Correction Field failure Variation Missing parts	Process failure Mis-loaded part Batch process Inspect-in quality Incapable machines	GembaSigma Pokayoke One-piece pull Built-in quality 3P Jidoka

Balanced Scorecard

2009-01-15T16:14:00.000+07:00

Balanced Scorecard
Put your visions into practice

What is Balanced Scorecard?

Balanced Scorecard (BSC) is a concept helping you translate strategy into action. BSC start

s from the company vision and strategies, from here critical success factors are defined. Measures are constructed that aid target-setting and performance measurement in areas critical to the strategies. Hence, Balanced Scorecard is a performance measurement system, derived from vision and strategy, and reflecting the most important aspects of the business. The Balanced Scorecard (BSC) concept supports strategic planning and implementation by federating the actions of all parts of

an organization around a common understanding of its goals, and by facilitating the assessment and upgrade of strategy.

Traditional performance measurement, focusing on external accounting data, was quickly becoming obsolete and something more was needed to provide the information age enterprises with efficient planning tools. For t

his purpose Kaplan & Norton introduced four different perspectives from which a company's activity can be evaluated:

Financial perspective (how do we perceive our shareholders?)
Customer perspective (how do we perceive our customers?)
Process perspective (in what processes should we excel to succeed?)
Learning and innovation perspective (how will we sustain our ability to change and improve?)

Figure 1:
Create a Balanced Scorecard: You have to identify a vision. Where is the organization going? By identifying strategies you learn about how you will get there. Define Critical Success Factors and perspectives, which means you have to ask what do we have to do well in each perspective. Thereafter ask how do we measure that everything is going the expected way? Then it is necessary think about evaluating your Scorecard. Consider how do we ensure that we are measuring the right things? Based on this work you should create action plans and plan reporting and operation of the Scorecard. How do we manage the Scorecard? Which persons should have reports and what should the reports look like?

Figure 2:
The picture shows a very general example of a Scorecard. Where are we going? The vision: "We should dominate the market." How? By focusing on cost efficiency, high quality and by investing in new technologies. In which perspectives should we excel at what? Responsibilities and action plans for achieving targets set are defined. You can easily create a Scorecard, but to create a manageable scorecard is a completely different thing!

Benefits

The benefits of applying Balanced Scorecard can be summarized as follows:

Balanced Scorecard helps align key performance measures with strategy at all levels of an organization.
Balanced Scorecard provides management with a comprehensive picture of business operations.
The methodology facilitates communication and understanding of business goals and strategies at all levels of an organization.
The balanced scorecard concept provides strategic feedback and learning.

ACCU BEKAS

DEFENSIVE DRIVER BEHAVIOUR

Flu Singapura (PENYAKIT)

Buka kaca mobil anda sebelum berkendaran !!!

OHSAS 18001:2007

Battery Rebuilding Manual & Supplies for Reconditioning:

A Realistic Definition Of Cycle Time

Visual Control

A BRIEF HISTORY OF LEAN MANUFACTURING

What Are We Learning Since We Started Learning to See

Develop skills to eliminate waste

EMPLOYEE EMPOWERMENT

EMPLOYEE EMPOWERMENT: A CRUCIAL INGREDIENT IN A TOTAL QUALITY MANAGEMENT STRATEGY.

1. Quality starts with People.

2. Participative management- more than a management buzzword.

3. "We are all in it together."(Bluestone, 1992: 34)

4. Empower from the "bottom up".

5. Employees- The most important asset in organizations.

6. Treat Your employees the way you want your customers to be treated.

7. Conclusion.

REFERENCE LIST:

Zero Quality Control

SSC AERO EV

TUTORIAL GADGET BLOG

Aki Bekas

Total Productive Maintenance

7 Wastes of Production

7 Wastes of Production

Balanced Scorecard

Balanced Scorecard Put your visions into practice

Balanced Scorecard
Put your visions into practice