<?xml version="1.0" encoding="UTF-8"?>
<?xml-stylesheet type="text/xsl" media="screen" href="/~d/styles/rss2full.xsl"?><?xml-stylesheet type="text/css" media="screen" href="http://feeds.feedburner.com/~d/styles/itemcontent.css"?><rss xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" version="2.0">
<channel>
<title><![CDATA[Unified Python Planet]]></title>
<description><![CDATA[A uniqued union of the Official and Unofficial Python planet feeds.  Generated by Atomisator FTW!]]></description>
<link>http://feeds2.feedburner.com/UnifiedPythonPlanet</link>
<language>en</language>
<copyright>Copyright 2008, Atomisator</copyright>
<pubDate>Sat, 15 Mar 2008 00:15:05 +0200</pubDate>
<lastBuildDate>Sat, 15 Mar 2008 00:15:05 +0200</lastBuildDate>
  <atom10:link xmlns:atom10="http://www.w3.org/2005/Atom" rel="self" href="http://feeds.feedburner.com/UnifiedPythonPlanet" type="application/rss+xml" /><atom10:link xmlns:atom10="http://www.w3.org/2005/Atom" rel="hub" href="http://pubsubhubbub.appspot.com" /><item>
    <title><![CDATA[Python 411 Podcast: Programming in Python 3]]></title>
    <description><![CDATA[This podcast reviews "Programming in Python 3" by Mark Summerfield and then talks about the transition from Python 2 to Python 3 as a critical juncture in the community. It also contains a ringing endorsement of the MIT Python video lectures.]]></description>
    <link><![CDATA[http://media.libsyn.com/media/awaretek/Python411_20091122_3000.mp3]]></link>
    <pubDate>2009-11-22 15:42:07</pubDate>
  </item>
  <item>
    <title><![CDATA[Montreal Python User Group: Montréal-Python 10: 2009-12-09 at UQAM]]></title>
    <description><![CDATA[<p>Montréal-Python 10 will take place at UQAM, on Wednesday 2009-12-09 in the President-Kenedy building.  We should have confirmation of the room number shourtly.  The PK building is located at <a href="http://www.uqam.ca/campus/pavillons/pk.htm">201 Président-Kenedy</a>, it also has a direct entrance to the Place-des-Arts metro station.</p>
<p>Here is our schedule for the evening:</p>
<ul>
<li>18h00: Opening</li>
<li>18h20: Announcements</li>
<li>18h30: Flash presentations</li>
<li>19h00: Break</li>
<li>19h20: Main presentation</li>
<li>20h30: Chat and drinks at <a href="http://www.brasseriebenelux.com/">Benelux</a></li>
</ul>
<p>Our main presenter will be <em>Chris Steel</em> and he&#8217;s going to walk us through <em>Universal Cake, a case study of using web2py for Web development</em>.</p>
<p>We still have a lot of open slots for flash presentations so don’t hesitate to propose a talk.</p>]]></description>
    <link><![CDATA[http://montrealpython.org/2009/11/22/montreal-python-10-2009-12-09-at-uqam/]]></link>
    <pubDate>2009-11-22 15:36:09</pubDate>
  </item>
  <item>
    <title><![CDATA[Ludvig Ericson: OS X Tip: Change shell to that of frontmost Finder window]]></title>
    <description><![CDATA[<div class="document">
<p>I was looking for any integration between Finder and Git (because I like GUIs sometimes. (I know about GitX.))</p>
<p>I came across this instead, a bash function (which works in zsh) that changes directory to that of the frontmost Finder window. It's convenient!</p>
<pre class="source">cdfinder<span class="o">()</span> <span class="o">{</span>
  <span class="nb">cd</span> <span class="s2">&quot;$( /usr/bin/osascript &lt;&lt;&quot;</span>    EOT<span class="s2">&quot;</span>
<span class="s2">    tell application &quot;</span>Finder<span class="s2">&quot;</span>
<span class="s2">      try</span>
<span class="s2">        set currFolder to (folder of the front window as alias)</span>
<span class="s2">      on error</span>
<span class="s2">        set currFolder to (path to home folder as alias)</span>
<span class="s2">      end try</span>
<span class="s2">      POSIX path of currFolder</span>
<span class="s2">    end tell</span>
<span class="s2">    EOT</span>
<span class="s2">    )&quot;</span>
<span class="o">}</span>
</pre>
<p>Reference: <a href="http://asktherelic.com/2009/01/31/osx-terminal-and-finder-integration/">asktherelic.com/.../osx-terminal-and-finder-integration/</a></p>
</div>

<p><a href="http://delicious.com/save?url=http://lericson.blogg.se/http://lericson.blogg.se/code/2009/november/os-x-tip-change-shell-to-that-of-frontmost-f.html&title=OS X Tip: Change shell to that of frontmost Finder window"><img src="http://static.delicious.com/img/delicious.small.gif" height="10" width="10" alt="Save on Delicious" /> delicious.com</a></p>


<img src="http://stats.blogg.se/?id=1395964" border="0" width="0" height="0" alt="" />]]></description>
    <link><![CDATA[http://lericson.blogg.se/code/2009/november/os-x-tip-change-shell-to-that-of-frontmost-f.html]]></link>
    <pubDate>2009-11-22 12:46:36</pubDate>
  </item>
  <item>
    <title><![CDATA[Catherine Devlin]]></title>
    <description><![CDATA[<a href="http://www.blogger.com/profile/07097826327266682983">Joseph Lisee</a>, author of the upcoming <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_175">Python submarine robot PyCon talk</a>, left a comment on my last post.  I think he was a little shy about me highlighting him.<br /><br />I'm sorry, Joseph.  You really left me no choice.<br /><br /><span>Completely Unfounded Rumors About <span><a href="http://us.pycon.org/2010/conference/talks/#proposal_link_175">"An Underwater Python: Tortuga the Python Powered Robot"</a></span></span><br /><br />Roll 1d6 for each hour spent in the Atlanta Hyatt bar.<ol><li>Joseph will announce the release of <em>asimov.py</em>, a pure-Python implementation of the Three Laws of Robotics.</li><li>Bring a swimsuit and snorkel.  One lucky audience member will be picked to join Tortuga in the hotel pool, where Tortuga will take a fish from their hand.*</li><li>Jozeph 'az been practeeseeng 'eez reedeeculous Jacques Cousteau accent for months and weel uze eet to deeleever zee eentire talk.</li><li>Several minutes into the presentation, Tortuga will overpower Joseph, throw him from the stage, and announce that humankind is obsolete and has been deprecated.</li><li>Attendees will be asked to pour out a libation to Poseidon.  Any caffeinated beverage may be used.</li><li>There will be a sprint to construct a tall, dapper companion to Tortuga for communication and protocol purposes.</li></ol><span>* - No, Tortuga won't be physically present at PyCon.  It's not that portable.  Believe me, the program committee asked!</span><div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/11802292-6059972531702955784?l=catherinedevlin.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://catherinedevlin.blogspot.com/2009/11/joseph-lisee-author-of-upcoming-python.html]]></link>
    <pubDate>2009-11-22 10:11:07</pubDate>
  </item>
  <item>
    <title><![CDATA[Steve Holden: Links for 2009-11-21 [del.icio.us]]]></title>
    <description><![CDATA[<ul>
<li><a href="http://anonymousdev.wordpress.com/2009/06/14/an-open-letter-to-it-management/">An open letter to IT Management</a><br />
Heh, what developers want from their senior managers</li>
<li><a href="http://www.jotform.com/">JotForm - Easiest Form Builder</a><br />
Neat little form builder tool</li>
</ul><img src="http://feeds.feedburner.com/~r/ForSomeValueOfMagic/~4/yGCon2T_A5s" height="1" width="1" />]]></description>
    <link><![CDATA[http://feedproxy.google.com/~r/ForSomeValueOfMagic/~3/yGCon2T_A5s/steve.holden]]></link>
    <pubDate>2009-11-22 08:00:00</pubDate>
  </item>
  <item>
    <title><![CDATA[Alex Gaynor: A Bit of Benchmarking]]></title>
    <description><![CDATA[PyPy recently posted some <a href="http://morepypy.blogspot.com/2009/11/some-benchmarking.html">interesting benchmarks</a> from the computer language shootout, and in my last post about Unladen Swallow I described a patch that would hopefully be landing soon.  I decided it would be interesting to benchmarks something with this patch.  For this I used James Tauber's <a href="http://github.com/jtauber/mandelbulb">Mandelbulb</a> application, at both 100x100 and 200x200.  I tested CPython, Unladen Swallow Trunk, Unladen Swallow Trunk with the patch, and a recent PyPy trunk (compiled with the JIT).  My results were as follows:<br /><br /><span class="Apple-style-span">100<br /></span>CPython 2.6.4                   17s<br />Unladen Swallow Trunk           16s<br />Unladen Swallow Trunk + Patch   13s<br />PyPy Trunk                      10s<br /><br /><span class="Apple-style-span">200<br /></span>CPython 2.6.4                   64s<br />Unladen Swallow Trunk           52s<br />Unladen Swallow Trunk + Patch   49s<br />PyPy                            46s<br /><br />Interesting results.  At 100x100 PyPy smokes everything else, and the patch shows a clear benefit for Unladen.  However, at 200x200 both PyPy and the patch show diminishing returns.  I'm not clear on why this is, but my guess is that something about the increased size causes a change in the parameters that makes the generated code less efficient for some reason.<br /><br />It's important to note that Unladen Swallow has been far less focussed on numeric benchmarks than PyPy, instead focusing on more web app concerns (like template languages).  I plan to benchmark some of these as time goes on, particularly after PyPy merges their "faster-raise" branch, which I'm told improves PyPy's performance on Django's template language dramatically.<div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/7176062489626496619-3233101122886270884?l=lazypython.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://lazypython.blogspot.com/2009/11/bit-of-benchmarking.html]]></link>
    <pubDate>2009-11-22 00:45:02</pubDate>
  </item>
  <item>
    <title><![CDATA[Floris Bruynooghe: New Python System Information release!]]></title>
    <description><![CDATA[<p>I've just released <a href="http://pypi.python.org/pypi/PSI/0.3b2">a new version of PSI</a>!  <a href="http://bitbucket.org/chrismiles/psi/wiki/Home">PSI</a> is a cross-platform <a href="http://python.org">Python</a> package providing real-time access to processes and other miscellaneous system information such as architecture, boottime and filesystems.  Among the highlights of this release are:</p>
<ul>
<li><em>Improved handling of time:</em> We now have our <a href="http://bitbucket.org/chrismiles/psi/wiki/TimeAPI">own object to represent time</a>.  This may seem silly at first but it actually makes it easier to use <em>all</em> the normal ways of representing time easily as well as provide the highest possible accuracy.</li>
<li><em>Improved handling of process names and arguments:</em> <a href="http://bitbucket.org/chrismiles/psi/wiki/ProcArgsExe">There is an entire wiki page dedicated to this</a>, but basically this simplifies presenting sensible process names to users massively since some attributes will always have meaningful values.</li>
<li><em>Restructured exceptions:</em> Whenever accessing attributes you will get a subclass of <tt>AttributeError</tt> like it should be so now you can happily use <tt>getattr()</tt>.</li>
<li><em>New experimental methods on Process objects:</em>  You can now send signals to processes using the <tt>.kill()</tt> method and find their children by using the <tt>.children()</tt> method.
<li><em>New experimental mount module:</em> You can get detailed information about all mounted filesystems using this new module.  It provides mount information as well as usage.</li>
</li></ul>
<p>Another notable improvement is the ability to read the arguments of a 64-bit process while running inside a 32-bit python process on Solaris.  It's small and almost no-one will notice it but make it so much more consistent!</p>

<p><b>Release early, release often: fail</b></p>
<p>Now for the bad news: all this means the API has changed in a backwards incompatible way.</p>
<p>It was already pretty obvious shortly after the last release that this would happen and was the reason I was hoping to release a new version soon.  But that didn't happen.  Although the last version had a "beta" version number on it it's trove classifier still claimed to be "alpha" and in end we don't promise API stability till we hit 1.0.  But it's still not nice.  Once we hit 0.3 we will actually try not to introduce changes to the API if possible.  We intend to help this by using <tt>FutureWarning</tt> for APIs we're not sure about yet.  In the mean time let's see how the <tt>Process</tt> API holds out during this release, hopefully it will prove to be good and require no more changes.</p>

<b>Credits</b>
<p>As before, thanks to <a href="http://chrismiles.info/">Chris Miles</a> and Erick Tryzelaar for helping out.</p><div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/14094861-2238116773993494288?l=bruynooghe.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://bruynooghe.blogspot.com/2009/11/new-python-system-information-release.html]]></link>
    <pubDate>2009-11-21 15:59:35</pubDate>
  </item>
  <item>
    <title><![CDATA[IronPython-URLs: Face Detection with IronPython]]></title>
    <description><![CDATA[Face detection in images is very cool (and perhaps a little bit scary), and with the help of <a href="http://www.emgu.com/wiki/index.php/Setting_up_Emgu_CV_and_IronPython">Emgu CV</a> it can be done from IronPython. This blog entry from Clark Updike shows how.<br />
<ul><li><a href="http://clarkupdike.blogspot.com/2009/11/face-detection-hello-world-in.html">Face Detection "Hello World" in IronPython using Emgu CV and OpenCV</a></li>
</ul><blockquote>&nbsp;A couple notes compared to the Emgu wiki version--I was able to get everything working without having to disturb the IronPython install (I didn't copy any files into the IronPython start directory). I simply linked used <span>sys.path</span> to add the locations where the dll's live. Also, I did explicit import for everything. It's a bit more work to figure out what needs to be imported, but it avoids namespace pollution issues. Also, the <span>img.Draw</span> line needed a few tweaks. I had to drop the [float] bit from the original. And with the original version, I was also getting an error on this same line, saying:<br />
<br />
<span>TypeError: expected MCvBox2D, got MCvAvgComp</span><br />
<br />
I was able to work around this by passing in the "<span>.rect</span>" rectangle attribute to the <span>Draw</span> method (I'm guessing the api has evolved since the 1.4 Emgu version used for the original). Lastly, I was getting to objects detected--so I used parameters to the detector to only get the single face in the image (basically by telling it to use a larger minimum detection size, <span>minSearchScale</span>). Anyway, now it works the way I was hoping.<br />
</blockquote><div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/3604515438787408842-36831398645634642?l=ironpython-urls.blogspot.com" alt="" /></div>
<p><a href="http://feedads.g.doubleclick.net/~a/GwwIX5MhytEP7M2wf1kaowbfimI/0/da"><img src="http://feedads.g.doubleclick.net/~a/GwwIX5MhytEP7M2wf1kaowbfimI/0/di" border="0" ismap="true" /></a><br />
<a href="http://feedads.g.doubleclick.net/~a/GwwIX5MhytEP7M2wf1kaowbfimI/1/da"><img src="http://feedads.g.doubleclick.net/~a/GwwIX5MhytEP7M2wf1kaowbfimI/1/di" border="0" ismap="true" /></a></p><div class="feedflare">
<a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=oHgmSgySvBE:n8NpzGiEUDQ:4cEx4HpKnUU"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?i=oHgmSgySvBE:n8NpzGiEUDQ:4cEx4HpKnUU" border="0" /></a> <a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=oHgmSgySvBE:n8NpzGiEUDQ:YwkR-u9nhCs"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?d=YwkR-u9nhCs" border="0" /></a> <a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=oHgmSgySvBE:n8NpzGiEUDQ:F7zBnMyn0Lo"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?i=oHgmSgySvBE:n8NpzGiEUDQ:F7zBnMyn0Lo" border="0" /></a>
</div><img src="http://feeds.feedburner.com/~r/IronpythonUrls/~4/oHgmSgySvBE" height="1" width="1" />]]></description>
    <link><![CDATA[http://feedproxy.google.com/~r/IronpythonUrls/~3/oHgmSgySvBE/face-detection-with-ironpython.html]]></link>
    <pubDate>2009-11-21 15:34:44</pubDate>
  </item>
  <item>
    <title><![CDATA[IronPython-URLs: Databinding and WCF Services with IronPython 2.6]]></title>
    <description><![CDATA[One of the important new features in IronPython 2.6 is the <span>__clrtype__</span> metaclass.The <span>__clrtype__</span> metaclass allows you to create a real .NET class that backs your Python classes. This is important because there are many .NET features that *<i>require</i>* a real .NET class: which includes databinding and implementing WCF services (Windows Communication Foundation).<br />
<br />
The problem with <span>__clrtype__</span> is that it requires dealing with low level details; namely building the class yourself from IL bytecode. Harry Pierson and Shri Borde have been working on a library (<span>clrtype.py</span>) to make this simpler.<br />
<br />
Lukáš Čenovský has <a href="http://ironpython-urls.blogspot.com/2009/11/wcf-service-from-ironpython.html">looked at this before</a> but hit limitations with what <span>clrtype</span> made possible. In three new blog entries he demonstrates how to use <span>__clrtype__</span> with databinding in WPF and Silverlight and to implement WCF services.<br />
<ul><li><a href="http://gui-at.blogspot.com/2009/11/inotifypropertychanged-in-ironpython.html">INotifyPropertyChanged and databinding in IronPython WPF</a></li>
</ul><blockquote>&nbsp;<a href="http://msdn.microsoft.com/en-us/library/system.componentmodel.inotifypropertychanged.aspx">INotifyPropertyChanged</a> is important interface for building WPF or Silverlight applications using <a href="http://en.wikipedia.org/wiki/Model_View_ViewModel">M-V-VM</a> concept (<a href="http://msdn.microsoft.com/en-us/magazine/dd419663.aspx">MSDN article</a>).<br />
<br />
In simple language, you have a <b>Model</b> which provides access to your data (e.g in database, files, web, etc.). Then you have a <b>ViewModel</b> that access data in the Model via Model's interface and provides data to a <b>View</b> which is XAML file with UI layout. Linkage between ViewModel and View is done by binding that utilizes <span>PropertyChanged</span> event to properly update all UI elements.<br />
<br />
I have found two examples how to implement <span>INotifyPropertyChanged</span> interface in IronPython. <a href="http://lists.ironpython.com/pipermail/users-ironpython.com/2009-August/010938.html">The first one</a> uses <span>__setattr__</span> hook. Personally, I don't like it - it is not clear and easily readable code. <a href="http://palepoli.skr.jp/wp/2009/06/28/wpf-listview-databinding-for-ironpython/">The second one</a> is better because it uses properties. But you have to write <span>self.OnPropertyChanged("my_property_name")</span> for every property. Not ideal.<br />
<br />
That's why I sit down and write a <span>notify_property</span>.<br />
</blockquote><ul><li>&nbsp;<a href="http://gui-at.blogspot.com/2009/11/inotifypropertychanged-and-databinding.html">INotifyPropertyChanged and databinding in Silverlight</a></li>
</ul>This article uses the updated <span>clrtype</span> module to apply the databinding technique to Silverlight. The cool thing is that I'm already using this technique for databinding with the Silverlight Toolkit <span>DataGrid</span> in my new job. No more stub C# proxy classes, yay!<br />
<ul><li><a href="http://gui-at.blogspot.com/2009/11/wcf-service-in-pure-ironpython.html">WCF Service in pure IronPython</a></li>
</ul>&nbsp;Even using <span>__clrtype__</span> you still couldn't use WCF (for creating and consuming web services) from pure IronPython because it requires *<i>creating</i>* interfaces, which <a href="http://ironpython-urls.blogspot.com/2009/11/wcf-service-from-ironpython.html">couldn't be done</a>. With the latest improvements to <span>clrtype</span> it is now possible.<br />
<blockquote>I wrote about implementing WCF service in IronPython a couple of weeks ago. Meanwhile I pushed Shri a little bit with the <a href="http://gui-at.cendaweb.cz/2009/11/clrtype.py">clrtype.py</a> and he has implemented <span>ClrInterface</span> metaclass there so we can create the whole WCF service in IronPython now.<br />
<br />
The IronPython interface implementation is straightforward. <br />
</blockquote><blockquote>Also switching from C# interface to IronPython interface is easy.<br />
<br />
</blockquote><div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/3604515438787408842-8213403651007873082?l=ironpython-urls.blogspot.com" alt="" /></div>
<p><a href="http://feedads.g.doubleclick.net/~a/ZV8xCZ4qbsqWzh-YMzBzMB6NlfU/0/da"><img src="http://feedads.g.doubleclick.net/~a/ZV8xCZ4qbsqWzh-YMzBzMB6NlfU/0/di" border="0" ismap="true" /></a><br />
<a href="http://feedads.g.doubleclick.net/~a/ZV8xCZ4qbsqWzh-YMzBzMB6NlfU/1/da"><img src="http://feedads.g.doubleclick.net/~a/ZV8xCZ4qbsqWzh-YMzBzMB6NlfU/1/di" border="0" ismap="true" /></a></p><div class="feedflare">
<a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=tf1brfwHNKE:j_lDKy8ihG0:4cEx4HpKnUU"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?i=tf1brfwHNKE:j_lDKy8ihG0:4cEx4HpKnUU" border="0" /></a> <a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=tf1brfwHNKE:j_lDKy8ihG0:YwkR-u9nhCs"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?d=YwkR-u9nhCs" border="0" /></a> <a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=tf1brfwHNKE:j_lDKy8ihG0:F7zBnMyn0Lo"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?i=tf1brfwHNKE:j_lDKy8ihG0:F7zBnMyn0Lo" border="0" /></a>
</div><img src="http://feeds.feedburner.com/~r/IronpythonUrls/~4/tf1brfwHNKE" height="1" width="1" />]]></description>
    <link><![CDATA[http://feedproxy.google.com/~r/IronpythonUrls/~3/tf1brfwHNKE/databinding-and-wcf-services-with.html]]></link>
    <pubDate>2009-11-21 15:30:16</pubDate>
  </item>
  <item>
    <title><![CDATA[Graham Dumpleton: Versions 3.0 and 2.7 of mod_wsgi are now available.]]></title>
    <description><![CDATA[No problems were reported with last release candidate and no one took issue with Python 3.X support, so have finally released mod_wsgi 3.0. Have also released a very minor update of 2.X branch as well in form of mod_wsgi 2.7. Unless significant issues come up, there will be no more releases from the 2.X branch.]]></description>
    <link><![CDATA[http://blog.dscpl.com.au/2009/11/versions-30-and-27-of-modwsgi-are-now.html]]></link>
    <pubDate>2009-11-21 12:42:30</pubDate>
  </item>
  <item>
    <title><![CDATA[Kamon Ayeva: Jumped in a new job and contemplating new challenges]]></title>
    <description><![CDATA[<div class="snap_preview"><br /><p>I have recently quit Ingeniweb for a job in an international organization involved in the promotion of cultural diversity and sustainable development, to only mention two of its activity fields.</p>
<p>I am in charge of website projects (in the context of the Communication department). There is a lot to do, the first thing being understanding the context, the way things work here, and the people&#8217;s expectations.</p>
<p>As for the tools and technologies side of things, there is not currently anything Python-based here. PHP (SPIP) rules ! Well, I guess it&#8217;s perceived as easy and more importantly, skills exist everywhere (<em>me looking in the direction of &#8220;web agencies&#8221;</em>).<br />
So, one of the interesting things will be to introduce Python, where it makes sense, in the not-too-far (hopefully) future. Anyway, I am confident that will happen one day. After all, it&#8217;s not always bad to be ahead of the time. You just have to wait, monitor, and talk to people everytime there is an opportunity. And you might be lucky and convince those who take the time to listen <img src="http://s.wordpress.com/wp-includes/images/smilies/icon_wink.gif" alt=";)" class="wp-smiley" /> </p>
  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/kayeva.wordpress.com/123/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/kayeva.wordpress.com/123/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/kayeva.wordpress.com/123/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/kayeva.wordpress.com/123/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/kayeva.wordpress.com/123/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/kayeva.wordpress.com/123/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/kayeva.wordpress.com/123/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/kayeva.wordpress.com/123/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/kayeva.wordpress.com/123/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/kayeva.wordpress.com/123/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=kayeva.wordpress.com&blog=827664&post=123&subd=kayeva&ref=&feed=1" /></div>]]></description>
    <link><![CDATA[http://kayeva.wordpress.com/2009/11/21/jumped-in-a-new-job-and-contemplating-new-challenges/]]></link>
    <pubDate>2009-11-21 11:44:50</pubDate>
  </item>
  <item>
    <title><![CDATA[Steve Holden: Links for 2009-11-20 [del.icio.us]]]></title>
    <description><![CDATA[<ul>
<li><a href="http://holdenweb.blogspot.com/2009/11/starting-2010-with-bang.html">Starting 2010 With a Bang: Classes in New York</a><br />
Time in the big apple *and* training? What more could a geek want?</li>
<li><a href="http://www.curledesign.com/everything-you-ever-wanted-to-know-about-twitter/">Everything you ever wanted to know about Twitter</a><br />
Encyclopedic twitter resource</li>
<li><a href="http://tenna10.googlepages.com/newstoamuse">Know where you're going</a><br />
You just might already be there</li>
<li><a href="http://www.samiviitamaki.com/?p=336">Eight ways to kill an idea</a><br />
Worth thinking about</li>
</ul><img src="http://feeds.feedburner.com/~r/ForSomeValueOfMagic/~4/5BltZ0HkaOU" height="1" width="1" />]]></description>
    <link><![CDATA[http://feedproxy.google.com/~r/ForSomeValueOfMagic/~3/5BltZ0HkaOU/steve.holden]]></link>
    <pubDate>2009-11-21 08:00:00</pubDate>
  </item>
  <item>
    <title><![CDATA[Heikki Toivonen: Turbogears2 on Dreamhost]]></title>
    <description><![CDATA[<p>It has been almost two years since I tested <a href="http://www.heikkitoivonen.net/blog/2008/01/31/turbogears-on-dreamhost/">Turbogears 1 on Dreamhost</a>. Back then it was quite difficult for me to get it running. But some additional personal experience and improvements in <a href="http://www.turbogears.org/2.0/docs/">Turbogears2</a> have made it a breeze. I tested with Turbogears 2.0 although I upgraded to 2.1a2 at some point.</p>
<p>First you need to get <a href="http://wiki.dreamhost.com/Python#Virtualenv">virtualenv install</a>ed, which is pretty simple after you have downloaded and unpacked the source tarball: <code>python2.5 virtualenv.py $HOME</code>. (I wanted it installed in $HOME, but you could use alternative locations as well.) This will install setuptools, but somehow not virtualenv. Then you just do <code>easy_install virtualenv</code>. You will also need PasteDeploy so do: <code>easy_install PasteDeploy</code>.</p>
<p>Next steps might be different for installing a Turbogears2 egg/application, but I used these instructions to install the wiki-20 tutorial in development mode. (To install a properly packaged app you probably just need to do: <code>easy_install app_tarball; paster make-config yourapp production.ini</code> and follow the instructions from FastCGI onwards.)</p>
<p>After that you just follow tg2 automatic <a href="http://www.turbogears.org/2.0/docs/main/DownloadInstall.html">installation instructions</a>.</p>
<p>Then use <code>paster quickstart</code> to create a new project template. <code>cd</code> to the created directory, and run <code>python setup.py develop</code> to download any missing dependencies and set things up for debugging and development.</p>
<p>Edit as instructed in the tutorial. Then <code>python setup-app development.ini</code>.</p>
<p>After that it is time to create the production ini: <code>paster make-config Wiki20 production.ini</code>.</p>
<p>Next step is getting this running with <a href="http://www.fastcgi.com/">FastCGI</a>. Create wiki20.fcgi in the webroot directory:</p>

<div class="wp_syntax"><div class="code"><pre class="python"><span>#!/home/your-username/path/to/tg2env/bin/python</span>
&nbsp;
<span>from</span> fcgi <span>import</span> WSGIServer <span># you could also use flup etc.</span>
&nbsp;
<span>from</span> paste.<span>deploy</span> <span>import</span> loadapp
real_app = loadapp<span>&#40;</span><span>'config:/home/your-username/path/to/production.ini'</span><span>&#41;</span>
&nbsp;
<span>def</span> myapp<span>&#40;</span>environ, start_response<span>&#41;</span>:
    environ<span>&#91;</span><span>'SCRIPT_NAME'</span><span>&#93;</span> =  <span># get rid of the .fcgi in urls</span>
    <span>return</span> real_app<span>&#40;</span>environ, start_response<span>&#41;</span>
&nbsp;
server = WSGIServer<span>&#40;</span>myapp<span>&#41;</span>
server.<span>run</span><span>&#40;</span><span>&#41;</span></pre></div></div>

<p>There are a couple of points of note here:</p>
<ul>
<li>I am using <a href="http://svn.saddi.com/py-lib/trunk/fcgi.py">fcgi.py</a> which seems to be slightly more reliable than flup on <a href="http://www.dreamhost.com/r.cgi?144282">Dreamhost</a>. You&#8217;d better edit fcgi.py so that you won&#8217;t <a href="http://www.heikkitoivonen.net/blog/2008/09/19/fcgipy-exposes-python-tracebacks-by-default/">show private information</a> to everyone in case of errors.</li>
<li>There is a trick to get rid of the .fcgi part from the URLs.</li>
</ul>
<p>Next we&#8217;ll need a <code>.htaccess</code> file:</p>

<div class="wp_syntax"><div class="code"><pre class="apache"><span># Enable Dreamhost stats</span>
&lt;<span>IfModule</span> mod_rewrite.c&gt;
<span>RewriteEngine</span> <span>On</span>
<span>RewriteBase</span> /
<span>RewriteCond</span> %{REQUEST_URI} ^/(stats|failed_auth\.html).*$ [NC]
<span>RewriteRule</span> . - [L]
&lt;/<span>IfModule</span>&gt; 
<span># FastCGI</span>
&lt;<span>IfModule</span> mod_rewrite.c&gt;
<span>RewriteEngine</span> <span>On</span>
<span>RewriteBase</span> /
<span>RewriteRule</span> ^wiki20\.fcgi/ - [L]
<span>RewriteRule</span> ^(.*)$ wiki20.fcgi/$<span>1</span> [L]
&lt;/<span>IfModule</span>&gt;</pre></div></div>

<p>Now when you go to your site, first time it is going to take a while to load your app, but after that things will be snappy as long as the app stays in memory.</p>]]></description>
    <link><![CDATA[http://www.heikkitoivonen.net/blog/2009/11/20/turbogears2-on-dreamhost/]]></link>
    <pubDate>2009-11-21 04:51:15</pubDate>
  </item>
  <item>
    <title><![CDATA[Simon Wittber: Giant, Python Powered Robots.]]></title>
    <description><![CDATA[<a href="http://2.bp.blogspot.com/_1srVB7Ihd-8/SX_S-hJqsXI/AAAAAAAAAIQ/FL1vuIkfRJE/s1600-h/IMG_1357.JPG"><img src="http://2.bp.blogspot.com/_1srVB7Ihd-8/SX_S-hJqsXI/AAAAAAAAAIQ/FL1vuIkfRJE/s320/IMG_1357.JPG" border="0" alt="" id="BLOGGER_PHOTO_ID_5296183658303631730" /></a>These are the robots I've been working on for the last 12 months. They each weigh about 11 tonnes and have a 17 meter reach. <br /><br />The control system is written in Python, with small sections of C which run in hard-real-time to guarantee safety. The robots work cooperatively, semi-autonomously, with drive-by-wire style assistance when under manual control.<br /><br /><a href="http://3.bp.blogspot.com/_1srVB7Ihd-8/SYBLjY7PfiI/AAAAAAAAAIY/c3jsLn8TmrE/s1600-h/IMG_1358.JPG"><img src="http://3.bp.blogspot.com/_1srVB7Ihd-8/SYBLjY7PfiI/AAAAAAAAAIY/c3jsLn8TmrE/s320/IMG_1358.JPG" border="0" alt="" id="BLOGGER_PHOTO_ID_5296316233146138146" /></a><strong>Update:</strong> added a close-up of the business end. This claw weighs just over 1 tonne, and gets hurled around at up to 3.5 meters per second.<div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/8935780327334775165-885571936897620190?l=entitycrisis.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://entitycrisis.blogspot.com/2009/01/giant-python-powered-robots.html]]></link>
    <pubDate>2009-11-21 03:37:51</pubDate>
  </item>
  <item>
    <title><![CDATA[Carl Trachte: Pycon 2010 pre-favorites - the Carl T. edition]]></title>
    <description><![CDATA[<a href="http://catherinedevlin.blogspot.com/2009/11/pycon-pre-favorites.html">Catherine Devlin</a> posted the talks she'd like to attend at Pycon.&nbsp; It was fun reading her picks - she has a great sense of humor, although I'm bummed that everyone now knows about the <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_175">submarine robot talk</a>, and I'll have to fight for room in the lecture hall to get a spot.<br /><br />These are my picks (not in order - the truth is I could spend all day talking about a lot of these talks - they are all good - too short a life - too many good talks):<br /><br />1) Ha, go to the depths of the sea to your Octopus' Garden with your submarine robot, Catherine.&nbsp; I'm heading skyward with<a href="http://us.pycon.org/2010/conference/talks/"> robots in space.</a><br /><br />&nbsp;2) <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_13">Jython in the Military</a>, is near and dear to me.&nbsp; Besides, bossman is giving the talk - never hurts to show up and support the team.<br /><br />3) While we're on the subject of Jython, <span id="proposal_link_65"><span><a href="http://us.pycon.org/2010/conference/talks/#proposal_link_65">Extending Java Applications with Jython</a> by Wierzbicki is one that has potential to make me less ignorant.</span></span><br /><span id="proposal_link_65"><span><br /></span></span><br /><span id="proposal_link_65"><span>4) My posts on this blog have all been about Python 3.x - <a href="http://www.blogger.com/goog_1258766007805">Chun's talk</a><a href="http://us.pycon.org/2010/conference/talks/#proposal_link_40">, Python 3:&nbsp; The Next Generation</a> and <a href="http://www.blogger.com/goog_1258766007812">Smith's talk</a><a href="http://us.pycon.org/2010/conference/talks/#proposal_link_117"> about Python 3.x string formatting</a> are two I could seriously benefit from.&nbsp; When Anthony Baxter gave a tutorial on Python 3 at OSCON a couple years back, I just about died when he said he wasn't going to cover new string formatting.&nbsp; He gave me this look like, "Wow, who are you, are you nuts?"&nbsp; And I gave him this look like, "A total Python nobody, and . . . as a matter of fact, yeah."&nbsp; Anyway, the string formatting one is pretty important to me.</span></span><br /><span id="proposal_link_65"><span><br /></span></span><br /><span id="proposal_link_65"><span>5) <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_52">Changes to Unittest</a> and <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_96">Intro to Unittest</a> - yeah, four years after being exposed to testing, I'm still taking baby steps - sue me.</span></span><br /><span id="proposal_link_65"><span><br /></span></span><br /><span id="proposal_link_65"><span>6) The Diversity Suite - one diversity talk and two technical ones - talks <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_49">Diversity as a Dependency</a>, <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_84">Infrastructure Construction in Africa</a>, <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_122">Hackerlab</a>.&nbsp;&nbsp;</span></span><br /><span id="proposal_link_65"><span>Anna R. is giving the diversity one - I attended her women in computing one a few years back and learned a bit, plus she was cool enough to let me dink around with her brand new minicomputer - a novelty at the time.</span></span><br /><span id="proposal_link_65"><span>There is so little about Africa out there on the web relative to Europe and the Far East - I want to see what's going on.</span></span><br /><a href="http://www.blogger.com/goog_1258766797878"><span id="proposal_link_65"><span>Hackerlab (actually </span></span></a><span id="proposal_link_122"><span><a href="http://us.pycon.org/2010/conference/talks/#proposal_link_122">Think Globally, Hack Locally - Teaching Python in Your Community) </a>is Leigh's talk.&nbsp; Leigh is a smart security person.&nbsp; In addition she's upbeat and happy.&nbsp; I, by contrast, am morose and depressive.&nbsp; I am hoping to get smarter and more upbeat through the process of osmosis.</span></span><br /><br /><span id="proposal_link_122"><span>7) The Python Language Suite - <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_55">The Mighty Dictionary</a>, <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_62">Deconstruction of an Object</a>, <a href="http://us.pycon.org/2010/conference/talks/#proposal_link_138">Decorators</a>, <a href="http://us.pycon.org/2010/conference/talks/"></a><a href="http://us.pycon.org/2010/conference/talks/#proposal_link_153">The Command Line</a>.&nbsp; I'm not as strong on some of the basics as I'd like to be.&nbsp; No shortage of places to learn and get up to speed.</span></span><br /><span id="proposal_link_122"><span><br /></span></span><br /><span id="proposal_link_122"><span>8) </span></span><span id="proposal_link_156"><span><a href="http://us.pycon.org/2010/conference/talks/#proposal_link_156">Dealing with unsightly data in the real world</a>.&nbsp; Wow, the story of my life - "<a href="http://www.lyrics007.com/Fugees%20Lyrics/Killing%20Me%20Softly%20Lyrics.html">Singing my life with his words, Killing me softly with his talk . . .</a>"</span></span><br /><span id="proposal_link_156"><span><br /></span></span><br /><span id="proposal_link_156"><span>There's a zillion other talks I'd like to attend; actually, I probably will end up attending only half of these.&nbsp; I'm not a web programmer - there's a ton of talks on that end of things.&nbsp; Check it out.<br /></span></span><div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/524230429673765509-5673138393956224687?l=pyright.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://pyright.blogspot.com/2009/11/pycon-2010-pre-favorites-carl-t-edition.html]]></link>
    <pubDate>2009-11-21 00:50:00</pubDate>
  </item>
  <item>
    <title><![CDATA[Mikeal Rogers: JSON Performance in Python]]></title>
    <description><![CDATA[<p>In part of my ongoing performance work in our CouchDB+Python application I&#8217;ve decided to sit down and profile JSON performance in the different open source libraries available for Python.</p>
<p>I ran <a href="http://gist.github.com/239887">this test</a> profiling <a href="http://docs.python.org/library/json.html">json</a> (pure Python simplejson) available in Python stdlib, <a href="http://code.google.com/p/simplejson/">simplejson</a> compiled with C speedups, <a href="http://pypi.python.org/pypi/python-cjson/">cjson</a>, and <a href="http://code.google.com/p/jsonlib2/">jsonlib2</a>, with a large JSON document. The test decodes and encodes a large JSON object 100 times. It then runs that test 100 times in each library in succession in order to find the average encode/decode time for each library and minimize other environmental factors that may occur. These numbers were taken on my MacBook Air running Mac OS X 1.6.1 with the default Python 2.6.</p>
<p>The time represents in milliseconds how long it takes to encode/decode <a href="http://gist.github.com/239890">this JSON object</a> 100 times.</p>
<p><img src="http://www.mikealrogers.com/wp-content/uploads/2009/11/JSONPerf.001.png" alt="JSONPerf" title="JSONPerf" width="614" height="460" class="aligncenter size-full wp-image-696" /></p>
<p>I honestly didn&#8217;t expect the stdlib json to be this far behind. </p>
<p>Among the other C based libraries there isn&#8217;t a clear winner. cjson is the best decoder but the slowest encoder, simplejson compiled with C speedups is the fastest encoder but the slowest decoder while jsonlib2 is somewhere in the middle for both cases.</p>
<p>Also, annoyingly, cjson doesn&#8217;t implement the same API as the other libraries (dump and load functions are named encode and decode) making it much more difficult for a library to include support for all available libraries. Now rather than just being able to add a user defined json module I&#8217;ll need to add support for user defined parsing and encoding functions to <a href="http://github.com/mikeal/couchdb-pythonviews">couchdb-pythonviews</a>, <a href="http://github.com/mikeal/couchquery">couchquery</a>, and <a href="http://github.com/mikeal/couchdb-wsgi">couchdb-wsgi</a>.</p>]]></description>
    <link><![CDATA[http://www.mikealrogers.com/archives/695]]></link>
    <pubDate>2009-11-21 00:07:50</pubDate>
  </item>
  <item>
    <title><![CDATA[Alex Gaynor: Things College Taught me that the "Real World" Didn't]]></title>
    <description><![CDATA[<div>A while ago Eric Holscher blogged about <a href="http://ericholscher.com/blog/2009/nov/10/what-they-didnt-teach-me-college/">things he didn't learn in college.</a>  I'm going to take a different spin on it, looking at both things that I did learn in school that I wouldn't have learned else where (henceforth defined as my job, or open source programming), as well as thinks I learned else where instead of at college.</div><div><br /></div><div><span class="Apple-style-span">Things I learned in college:</span></div><div><br /></div><div>Big O notation, and algorithm analysis.  This is the biggest one, I've had little cause to consider this in my open source or professional work, stuff is either fast or slow and that's usually enough.  Learning rigorous algorithm analysis doesn't come up all the time, but every once in a while it pops up, and it's handy.</div><div><br /></div><div>C++.  I imagine that I eventually would have learned it myself, but my impetus to learn it was that's what was used for my CS2 class, so I started learning with the class then dove in head first.  Left to my own devices I may very well have stayed in Python/Javascript land.</div><div><br /></div><div>Finite automaton and push down automaton.  I actually did lexing and parsing before I ever started looking at these in class (see my blog posts from a year ago) using PLY, however, this semester I've actually been learning about the implementation of these things (although sadly for class projects we've been using Lex/Yacc).</div><div><br /></div><div><br /></div><div><span class="Apple-style-span">Things I learned in the real world:</span></div><div><br /></div><div>Compilers.  I've learned everything I know about compilers from reading my papers from my own interest and hanging around communities like Unladen Swallow and PyPy (and even contributing a little).</div><div><br /></div><div>Scalability.  Interesting this is a concept related to algorithm analysis/big O, however this is something I've really learned from talking about this stuff with guys like Mike Malone and Joe Stump.</div><div><br /></div><div>APIs, Documentation.  These are the core of software development (in my opinion), and I've definitely learned these skills in the open source world.  You don't know what a good API or documentation is until it's been used by someone you've never met and it just works for them, and they can understand it perfectly.  One of the few required, advanced courses at my school is titled, "Software Design and Documentation" and I'm deathly afraid it's going to waste my time with stuff like UML, instead of focusing on how to write APIs that people want to use and documentation that people want to read.</div><div><br /></div><div><br /></div><div>So these are my short lists.  I've tried to highlight items that cross the boundaries between what people traditionally expect are topics for school and topics for the real world.  I'd be curious to hear what other people's experience with topics like these are.</div><div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/7176062489626496619-8005726886588467982?l=lazypython.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://lazypython.blogspot.com/2009/11/things-college-taught-me-that-real.html]]></link>
    <pubDate>2009-11-21 00:03:59</pubDate>
  </item>
  <item>
    <title><![CDATA[IronPython-URLs: IronPython 2.6 Release Candidate 3]]></title>
    <description><![CDATA[IronPython 2.6 is the up-and-coming version of IronPython targeting compatibility with Python 2.6. As well as the new features in Python 2.6, IronPython 2.6 has several important new features specific to IronPython. These include:<br />
<ul><li>The <span>__clrtype__</span> metaclass for data binding and .NET attribute support</li>
<li>Implementation of the <span>ctypes</span> module</li>
<li>Support for Python stack frames and <span>sys.settrace</span>, which means the <span>pdb</span> debugger works</li>
<li>Better performance through adaptive compilation</li>
<li>Faster startup</li>
</ul>IronPython 2.6 Release Candidate 3 has just been released. The hope is that this will be the last release candidate before the final release:<br />
<ul><li><a href="http://ironpython.codeplex.com/Release/ProjectReleases.aspx?ReleaseId=36150">IronPython 2.6 Release Candidate 3 Release Notes and Download</a></li>
</ul><blockquote>We’re pleased to announce the third and hopefully final release candidate of IronPython 2.6. Release Candidate 3 only includes Silverlight-related changes pertaining to some incompatibilities between 2.6 RC1 and RC2. Those who utilize IronPython for non-Silverlight scenarios will happily find virtually no churn from RC2. <i><b>We strongly encourage everyone interested in Silverlight to test out this release ASAP because we plan on releasing IronPython 2.6 final in a week if no major new regressions are detected</b></i>. <br />
</blockquote><ul></ul><div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/3604515438787408842-8296650748830505938?l=ironpython-urls.blogspot.com" alt="" /></div>
<p><a href="http://feedads.g.doubleclick.net/~a/nLJY0R7I1jC6GC6izy7gJIF-is8/0/da"><img src="http://feedads.g.doubleclick.net/~a/nLJY0R7I1jC6GC6izy7gJIF-is8/0/di" border="0" ismap="true" /></a><br />
<a href="http://feedads.g.doubleclick.net/~a/nLJY0R7I1jC6GC6izy7gJIF-is8/1/da"><img src="http://feedads.g.doubleclick.net/~a/nLJY0R7I1jC6GC6izy7gJIF-is8/1/di" border="0" ismap="true" /></a></p><div class="feedflare">
<a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=uqn61NDurJQ:QUg_kdaHZfs:4cEx4HpKnUU"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?i=uqn61NDurJQ:QUg_kdaHZfs:4cEx4HpKnUU" border="0" /></a> <a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=uqn61NDurJQ:QUg_kdaHZfs:YwkR-u9nhCs"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?d=YwkR-u9nhCs" border="0" /></a> <a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=uqn61NDurJQ:QUg_kdaHZfs:F7zBnMyn0Lo"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?i=uqn61NDurJQ:QUg_kdaHZfs:F7zBnMyn0Lo" border="0" /></a>
</div><img src="http://feeds.feedburner.com/~r/IronpythonUrls/~4/uqn61NDurJQ" height="1" width="1" />]]></description>
    <link><![CDATA[http://feedproxy.google.com/~r/IronpythonUrls/~3/uqn61NDurJQ/ironpython-26-release-candidate-3.html]]></link>
    <pubDate>2009-11-20 23:20:09</pubDate>
  </item>
  <item>
    <title><![CDATA[IronPython-URLs: Two Articles: IronPython 2.0 and WPF Error]]></title>
    <description><![CDATA[Two more articles from Ibrahim Kivanc, the Turkish blogger who has written several articles on IronPython and Silverlight. Both of these articles are in English.<br />
<ul><li><a href="http://www.ibrahimkivanc.com/post/IronPython-2-and-Access-to-NET-Libraries.aspx">IronPython 2.0 and Access to .NET Libraries</a> <br />
</li>
</ul><blockquote>IronPython 2.0 version now runs on DLR (Dynamic Language Runtime). DLR is a platform on .NET which is host Dynamicly typed languages on it. Now Dynamic Languages Communicate eachother and C#,VB, COM Objects, .NET Libraries.<br />
<br />
IronPython, with 2.0 version runs on DLR (Dynamic Language Runtime); it’s a platform like CLR architecture. It’s host for Dynamic Languages on .NET. With this architecture Dynamic Languages now faster then running on CLR and easily communicate with other .NET objects!<br />
</blockquote><ul><li>&nbsp;<a href="http://www.ibrahimkivanc.com/post/IronPython-WPF-Error.aspx">IronPython WPF Error</a></li>
</ul>In my opinion IronPython Studio is not stable enough for production use. It does have the advantage of being integrated in Visual Studio so some people can't resist trying it out. (You can read my write-up of IronPython Studio at: <a href="http://www.voidspace.org.uk/ironpython/tools-and-ides.shtml">IronPython Tools and IDEs</a>.)<br />
<br />
If you insist on trying out IronPython Studio there are various minor trials and tribulations for you to overcome; using the WPF designer is one of them. In this article Ibrahim explains how to jump over this particular hurdle and get the WPF designer working in IronPython Studio.<div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/3604515438787408842-7276688592055015664?l=ironpython-urls.blogspot.com" alt="" /></div>
<p><a href="http://feedads.g.doubleclick.net/~a/tw9LkdGN_zBsr2UcBZIbrbC-zYY/0/da"><img src="http://feedads.g.doubleclick.net/~a/tw9LkdGN_zBsr2UcBZIbrbC-zYY/0/di" border="0" ismap="true" /></a><br />
<a href="http://feedads.g.doubleclick.net/~a/tw9LkdGN_zBsr2UcBZIbrbC-zYY/1/da"><img src="http://feedads.g.doubleclick.net/~a/tw9LkdGN_zBsr2UcBZIbrbC-zYY/1/di" border="0" ismap="true" /></a></p><div class="feedflare">
<a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=smv6hermDNM:kGhDuSDQax8:4cEx4HpKnUU"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?i=smv6hermDNM:kGhDuSDQax8:4cEx4HpKnUU" border="0" /></a> <a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=smv6hermDNM:kGhDuSDQax8:YwkR-u9nhCs"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?d=YwkR-u9nhCs" border="0" /></a> <a href="http://feeds.feedburner.com/~ff/IronpythonUrls?a=smv6hermDNM:kGhDuSDQax8:F7zBnMyn0Lo"><img src="http://feeds.feedburner.com/~ff/IronpythonUrls?i=smv6hermDNM:kGhDuSDQax8:F7zBnMyn0Lo" border="0" /></a>
</div><img src="http://feeds.feedburner.com/~r/IronpythonUrls/~4/smv6hermDNM" height="1" width="1" />]]></description>
    <link><![CDATA[http://feedproxy.google.com/~r/IronpythonUrls/~3/smv6hermDNM/two-articles-ironpython-20-and-wpf.html]]></link>
    <pubDate>2009-11-20 22:04:08</pubDate>
  </item>
  <item>
    <title><![CDATA[Steve Holden: Starting 2010 With a Bang]]></title>
    <description><![CDATA[Holden Web's <a href="http://holdenweb.com/py/djangomaster/">first one-day workshop</a> was, thanks to Jacob Kaplan Moss, a sell-out success. As a result, and partially due to some excellent feedback from the New York City Python Meetup group, we will be running the same workshop in <a href="http://hwebdjmc01.eventbrite.com/">New York on January 22</a>, again with Jacob presenting. We are also offering a <a href="http://hwebipmc01.eventbrite.com/">one-day IronPython workshop</a> presented by Michael Foord on January 21.<br /><br />Since the three-day <span>Introduction to Python</span> classes have been well-received in Virginia we are also offering <a href="http://hwebpyintnyc01.eventbrite.com/">that class in New York on January 18-20</a>.<br /><br />To try and make things easier for those attending and smooth out our administration we are using Eventbrite for the first time. I would really like to know how easy people find it to get information about our classes and to enroll for them. Anyone wanting specific information not mentioned in the course outlines is, of course, welcome to <a href="http://holdenweb.com/contact/Courses%20Inquiry/">contact us for further details</a>.<br /><br />If you would like to take one of these classes simply follow the links above (or <a href="http://holdenweb.eventbrite.com/">click here</a> for a list of all our current offerings, then just go to the ones you are interested in) and click the <span>Order Now</span> button which should be clearly visible. Once you have entered the details click the <span>Review Your Order</span> buttin, and you have fifteen minutes to check that you have entered the correct information before you click the <span>Pay Now</span> button. It really couldn't be much easier, I hope.<br /><br />We are also very interested to know what other event you would like us to run. This is the front end of a new venture for Holden Web, and your opinions and requirements (places you'd like to attend presentations as well as other topics) will help us to move in the right direction. So feel free to <a href="http://holdenweb.com/contact/Course%20suggestion/">contact us with your suggestions</a>, or make them in comments below. Thanks in advance for the feedback.<div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/496482-2024596211252833486?l=holdenweb.blogspot.com" alt="" /></div><div class="feedflare">
<a href="http://feeds.feedburner.com/~ff/ForSomeValueOfMagic?a=JlbFmCTSjeI:jxdtVElj25w:yIl2AUoC8zA"><img src="http://feeds.feedburner.com/~ff/ForSomeValueOfMagic?d=yIl2AUoC8zA" border="0" /></a> <a href="http://feeds.feedburner.com/~ff/ForSomeValueOfMagic?a=JlbFmCTSjeI:jxdtVElj25w:Jy2wSXVWK38"><img src="http://feeds.feedburner.com/~ff/ForSomeValueOfMagic?i=JlbFmCTSjeI:jxdtVElj25w:Jy2wSXVWK38" border="0" /></a>
</div><img src="http://feeds.feedburner.com/~r/ForSomeValueOfMagic/~4/JlbFmCTSjeI" height="1" width="1" />]]></description>
    <link><![CDATA[http://feedproxy.google.com/~r/ForSomeValueOfMagic/~3/JlbFmCTSjeI/starting-2010-with-bang.html]]></link>
    <pubDate>2009-11-20 21:41:20</pubDate>
  </item>
  <item>
    <title><![CDATA[Logilab: First Pylint Bug Day on Nov 25th, 2009 !]]></title>
    <description><![CDATA[<img align="right" alt="http://www.logilab.org/image/18785?vid=download" class="align-right" src="http://www.logilab.org/image/18785?vid=download" />
<p>Since we don't stop being overloaded here at Logilab, and we've got some encouraging feedback after the <a class="reference" href="http://www.logilab.org/blogentry/18020">&quot;Pylint needs you&quot;</a> post, we decided to take some time to introduce more &quot;community&quot; in <a class="reference" href="http://www.logilab.org/project/pylint">pylint</a>.</p>
<p>And the easiest thing to do, rather sooner than later, is a irc/jabber synchronized bug day, which will be held on <strong>Wednesday november 25</strong>. We're based in France, so main developpers will be there between around 8am and 19pm UTC+1.
If a few of you guys are around Paris at this time and wish to come at Logilab to sprint with us, contact us and we'll try to make this possible.</p>
<p>The focus for this bug killing day could be:</p>
<ul class="simple">
<li>using logilab.org tracker : getting an account, submitting tickets, triaging existing tickets...</li>
<li>using mercurial to develop pylint / astng</li>
<li>guide people in the code so they're able to fix simple bugs</li>
</ul>
<p>We will of course also try to kill a hella-lotta bugs, but the main idea is to help whoever wants to contribute to pylint... and plan for the next bug-killing day !</p>
<p>As we are in the process of moving to another place, we can't organize a sprint yet, but we should have some room available for the next time, so stay tuned :)</p>]]></description>
    <link><![CDATA[http://feedproxy.google.com/~r/logilaborg_en/~3/h-EFZZ6qlyI/18781]]></link>
    <pubDate>2009-11-20 18:38:54</pubDate>
  </item>
  <item>
    <title><![CDATA[Dave Beazley: Python Thread Deadlock Avoidance]]></title>
    <description><![CDATA[<p>One danger of writing programs based on threads is the potential for deadlock--a problem that almost invariably shows up if you happen to write thread code that tries to acquire more than one mutex lock at once.  For example:<br />
</p><p><blockquote><pre>a_lock = threading.Lock()
b_lock = threading.Lock()

def foo():
    with a_lock:
         ...
         with b_lock:
              # Do something
              ...

t1 = threading.Thread(target=foo)
t1.start()
</pre></blockquote></p><p>Code like that looks innocent enough until you realize that some other thread in the system also has a similar idea about locking--but acquires the locks in a slightly different order:<br />
</p><blockquote><pre>def bar():
    with b_lock:
         ...
         with a_lock:
              # Do something (maybe)
              ...
</pre></blockquote><p>Sure, the code might be lucky enough work "most" of the time.  However, you will suffer a thousand sorrows if both threads try to acquire those locks at about the same time and you have to figure out why your program is mysteriously nonresponsive.  <br />
</p><p>Computer scientists love to spend time thinking about such problems--especially if it means they can make up some diabolical problem about philosophers that they can put on an operating systems exam.  However, I'll spare you the details of that.<br />
</p><p>The problem of deadlock is not something that I would normally spend much time thinking about, but I recently saw some material talking about improved thread support in C++0x.  For example,  <a href="http://www.devx.com/SpecialReports/Article/38883/1954">this article</a> has some details.  In particular, it seems that C++0x offers a new locking operation <tt>std::lock()</tt> that can acquire multiple mutex locks all at once while avoiding deadlock. For example:<br />
</p><blockquote><pre>std::unique_lock&lt;std::mutex> lock_a(a.m,std::defer_lock);
std::unique_lock&lt;std::mutex> lock_b(b.m,std::defer_lock);
<b>std::lock(lock_a,lock_b);</b>      // Lock both locks
...
... do something involving data protected by both locks
...
</pre></blockquote><p>I don't actually know how C++0x implements its <tt>lock()</tt> operation, but I do know that one way to avoid deadlock is to put some kind of ordering on all of the locks in a program.   If you then strictly enforce a policy that all locks have to be acquired in increasing order, you can avoid deadlock.  Just as an example, if you had two locks A and B, you could assign a unique number to each lock such as A=1 and B=2.  Then, in any part of the program that wanted to acquire both lock A and B, you just make a rule that A always has to be acquired first (because its number is lower).   In such a scheme, the thread <tt>bar()</tt> shown earlier would simply be illegal.  That <tt>lock()</tt> operation in C++ is almost certainly doing something similar to this--that is, it knows enough about the locks so that they can acquired without deadlock.<br />
</p><p>All of this got me thinking--I wonder how hard it would be to implement the <tt>lock()</tt> operation in Python?   Not hard as it turns out.  First step is to change the name--given that <tt>acquire()</tt> is the typical method used to acquire a lock, let's just call the operation <tt>acquire()</tt> to make it more clear.  You can define <tt>acquire()</tt> as a context-manager and simply order locks according to their <tt>id()</tt> value like this:</p><blockquote><pre>class acquire(object):
    def __init__(self,*locks):
        self.locks = sorted(locks, key=lambda x: id(x))
    def __enter__(self):
        for lock in self.locks:
            lock.acquire()
    def __exit__(self,ty,val,tb):
        for lock in reversed(self.locks):
            lock.release()
        return False
</pre></blockquote><p>Okay, that was easy enough to do, but does it work?   Let's try it on the classic dining philosophers problem (look it up if you need a refresher):</p><blockquote><pre>import threading

# The philosopher thread
def philosopher(left, right):
    while True:
        with acquire(left,right):
             print threading.currentThread(), "eating"

# The chopsticks
NSTICKS = 5
chopsticks = [threading.Lock() 
              for n in xrange(NSTICKS)]

# Create all of the philosophers
phils = [threading.Thread(target=philosopher,
                          args=(chopsticks[n],chopsticks[(n+1) % NSTICKS]))
         for n in xrange(NSTICKS)]

# Run all of the philosophers
for p in phils:
    p.start()
</pre></blockquote><p>If you try this code, you'll find that the philosophers run all day with no deadlock. Just as an experiment, you can try changing the <tt>philosopher()</tt> implementation to one that acquires the locks separately:</p><blockquote><pre>def philosopher(left, right):
    while True:
        with left:
             with right:
                 print threading.currentThread(), "eating"
</pre></blockquote><p>Yep, almost instantaneously deadlock.  So, as you can see, our <tt>acquire()</tt> operation seems to be working.</p><p>There's still one last aspect of this experiment that needs to be addressed.   One potential problem with our <tt>acquire()</tt> operation is that it doesn't prevent a user from using it in a nested manner as before.  For example, someone might write code like this:</p><blockquote><pre>with acquire(a_lock,b_lock):
     ...
     with acquire(c_lock, d_lock):
          ...
</pre></blockquote><p>Catching such cases at the time of definition would be difficult (if not impossible).  However, we could make the <tt>acquire()</tt> context manager keep a record of all previously acquired locks using a list placed in thread local storage.   Here's a new implementation--and just for kicks, I'm going to switch it over to a context manager defined by a generator (mainly because I can and generators are cool):</p><blockquote><pre>import threading
from contextlib import contextmanager

local = threading.local()
@contextmanager
def acquire(*locks):
    locks = sorted(locks, key=lambda x: id(x))   
    acquired = getattr(local,"acquired",[])
    # Check to make sure we're not violating the order of locks already acquired   
    if acquired:
        if max(id(lock) for lock in acquired) >= id(locks[0]):
            raise RuntimeError("Lock Order Violation")
    acquired.extend(locks)
    local.acquired = acquired
    try:
        for lock in locks:
            lock.acquire()
        yield
    finally:
        for lock in reversed(locks):
            lock.release()
        del acquired[-len(locks):]
</pre></blockquote><p>If you use this version, you'll find that the philosophers work just fine as before.  However, now consider this slightly modified version with the nested acquires:</p><blockquote><pre># The philosopher thread                                                                                             
def philosopher(left, right):
    while True:
        with acquire(left):
            with acquire(right):
                print threading.currentThread(), "eating"
</pre></blockquote><p>Unlike the previous version that had nested <tt>with</tt> statements and deadlocked, this one runs.  However, one of the philosophers crashes with a nasty traceback:</p><blockquote><pre>Exception in thread Thread-5:
Traceback (most recent call last):
  File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/threading.py", line 522, in __bootstrap_inner
    self.run()
  File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/threading.py", line 477, in run
    self.__target(*self.__args, **self.__kwargs)
  File "hier4.py", line 53, in philosopher
    with acquire(right):
  File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/contextlib.py", line 16, in __enter__
    return self.gen.next()
  File "hier4.py", line 35, in acquire
    raise RuntimeError("Lock Order Violation")
RuntimeError: Lock Order Violation
</pre></blockquote><p>Very good.  That's exactly what we wanted.</p><p>So, what's the moral of this story.  First of all, I don't think you should use this as a license to go off and write a bunch of multithreaded code that relies on nested lock acquisitions.  Sure, the context manager might catch some potential problems, but it won't change the fact that you'll still want to blow your head off after debugging some other horrible problem that comes up with your overly clever and/or complicated design.<br />
</p><p>I think the main take-away is an appreciation for Python's context-manager feature.  There's so much more you can do with a context manager than simply closing a file or releasing an individual lock.</p><p>Disclaimer: I didn't do a hugely exhaustive internet search to see if anyone else had implemented anything similar to this in Python.  If you know of some links to related work, tell me.  I'll add them here.</p><div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/36456651-84152637118440889?l=www.dabeaz.com%2Fblog%2Fdablog.html" alt="" /></div>]]></description>
    <link><![CDATA[http://www.dabeaz.com/blog/2009/11/python-thread-deadlock-avoidance_20.html]]></link>
    <pubDate>2009-11-20 15:04:52</pubDate>
  </item>
  <item>
    <title><![CDATA[Ned Batchelder's blog: On business English]]></title>
    <description><![CDATA[<p>I've noticed in the office, people often refer to meetings with just an
adjective phrase, letting "meeting" be implied: "I have to go, I have a 2:00".
Why don't we carry this to its logical extreme?  Let's just say things like,
</p><blockquote><div>
<p>I have to get ready for the weekly.</p>
<p>Lunch has to be quick, I have to get back for a boring.</p>
<p>I think I'm going to skip the pointless.</p>
</div></blockquote>]]></description>
    <link><![CDATA[http://nedbatchelder.com/blog/200911/on_business_english.html]]></link>
    <pubDate>2009-11-20 10:43:03</pubDate>
  </item>
  <item>
    <title><![CDATA[Spyced: Automatic project structure inference]]></title>
    <description><![CDATA[<p>
David MacIver has an interesting blog entry up about <a href="http://www.drmaciver.com/2009/04/determining-logical-project-structure-from-commit-logs">determining logical project structure via commit logs</a>.  I was very interested because <a href="https://issues.apache.org/jira/browse/CASSANDRA-27">one of Cassandra's oldest issues</a> is creating categories for our JIRA instance.  (I've never been a big fan of JIRA, but you work with the tools you have.  Or the ones the ASF inflicts on you, in this case.)
<p>
The desire to add extra work to issue reporting for a young project like Cassandra strikes me as slightly misguided in the first place.  I have what may be an excessive aversion to overengineering, and I like to see a very clear benefit before adding complexity to anything, even an issue tracker.  Still, I was curious to see what David's clustering algorithm made of things.  And after pestering him to show me how to run his code I figure I owe it to him to <a href="http://people.apache.org/%7Ejbellis/maciver-clusters.txt">show my results</a>.
<p>
In general it did a pretty good job, particularly with the mid-sized groups of files.  The large groups are just noise; the small groups, well, it's not exactly a revelation that Filter and FilterTest go together.  I'd be tempted to play with it more but with only about two months and 250 commits in the apache repo there's not really all that much data there.  (Cassandra's first two years were in an internal Facebook repository.)  Working with data that exists as a side effect of natural activity is fascinating.<div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/11683713-5448487737287597931?l=spyced.blogspot.com" alt="" /></div></p></p></p>]]></description>
    <link><![CDATA[http://spyced.blogspot.com/2009/04/automatic-project-structure-inference.html]]></link>
    <pubDate>2009-11-20 05:29:06</pubDate>
  </item>
  <item>
    <title><![CDATA[Catherine Devlin: PyCon pre-favorites]]></title>
    <description><![CDATA[When I look over the <a href="http://us.pycon.org/2010/conference/talks/">PyCon 2010 talk list</a>, I'd like to be at about half of them (a physical impossibility, until I master self-multiplexing).  Still, these are the ones that I'll move heaven and earth to be at.  What about you - what are your favorites?<dl><dt><a href="http://us.pycon.org/2010/conference/talks#proposal_link_65">Extending Java Applications with Jython </a></dt><dd>I'm hopeful that this can really move Jython from my "stuff I think is cool" box to my "stuff I use every day" box.</dd><dt><a href="http://us.pycon.org/2010/conference/talks#proposal_link_67">IronPython Tooling</a></dt><dd>This is going to cover development environments and tools for debugging and profiling... pretty much a necessity in the .NET world.  I also hope to use the video of this talk in the future in talking to the hordes of programmers around here who live and breathe Visual Studio.</dd><dt><a href="http://us.pycon.org/2010/conference/talks#proposal_link_71">Python in the Browser </a></dt><dd>Silverlight is way too cool to leave to the C# kids.</dd><dt><a href="http://us.pycon.org/2010/conference/talks#proposal_link_122">Think Globally, Hack Locally - Teaching Python in Your Community </a></dt><dd>As a local group-leader type geek, I'd love to start some of these Hack Nights.</dd><dt><a href="http://us.pycon.org/2010/conference/talks#proposal_link_133">Dude, Where's My Database?</a></dt><dd>There were <span>so many</span> proposals for descriptions of non-relational databases - but this one really stands out because it looks at the huge picture, classifying databases by their broad category and highlighting what makes each category beneficial for particular purposes.</dd><dt><a href="http://us.pycon.org/2010/conference/talks#proposal_link_137">Sprox: data driven web development </a></dt><dd>I confess - I've fallen behind the TurboGears world lately.  Nobody's demanded a dynamic web app of me for a while, and TG has moved too fast for me to keep track of it.  When last I was involved, Sprox was just emerging.  I hope this talk will help me catch up.</dd><dt><a href="http://us.pycon.org/2010/conference/talks#proposal_link_86">Revisioned Databases for MultiUser Editing </a></dt><dd>Revisioned databases are an interesting concept, and seeing how one was actually developed should warm my datageek heart.</dd><dt><a href="http://us.pycon.org/2010/conference/talks#proposal_link_153">Easy command-line applications with cmd and cmd2</a></dt><dd>Interactive command-line interfaces were good enough for ZORK, and they're good enough for you!  cmd and cmd2 make them crazy-easy.  (I'll get in trouble if I don't go to this one, since I'm the speaker.)</dd><dt><a href="http://us.pycon.org/2010/conference/talks#proposal_link_156">Dealing with unsightly data in the real world</a></dt><dd>Gathering data from disparate, chaotic sources is a big part of pretty much everybody's life.  I'm eager for any new insights.</dd><dt><a href="http://us.pycon.org/2010/conference/talks#proposal_link_175">An Underwater Python: Tortuga the Python Powered Robot</a></dt><dd>because, deep down inside, people everywhere are the same; we all want to be loved, <span>and Python-powered robot submarines</span>.</dd></dl><div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/11802292-7739797831900664217?l=catherinedevlin.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://catherinedevlin.blogspot.com/2009/11/pycon-pre-favorites.html]]></link>
    <pubDate>2009-11-20 03:44:37</pubDate>
  </item>
  <item>
    <title><![CDATA[Imaginary Landscape: Permission Based File Serving]]></title>
    <description><![CDATA[<p>One issue I've run into a couple times while working with Django is the need to serve files to users based on permissions. The first situation occurred with a store we were building that would allow for electronic versions of books to be sold. These books would typically be ...</p>]]></description>
    <link><![CDATA[http://www.chicagodjango.com/blog/permission-based-file-serving/]]></link>
    <pubDate>2009-11-20 00:38:00</pubDate>
  </item>
  <item>
    <title><![CDATA[Alex Gaynor: Another Pair of Unladen Swallow Optimizations]]></title>
    <description><![CDATA[Today a <a href="http://code.google.com/p/unladen-swallow/source/detail?r=904">patch of mine</a> was committed to Unladen Swallow.  In the past weeks I've described some of the optimizations that have gone into Unladen Swallow, in specific I looked at removing the allocation of an argument tuple for C functions.  One of the "on the horizon" things I mentioned was extending this to functions with a variable arity (that is the number of arguments they take can change).  This has been implemented for functions that take a finite range of argument numbers (that is, they don't take *args, they just have a few arguments with defaults).  This support was used to optimize a number of builtin functions (dict.get, list.pop, getattr for example).<br /><br />However, there were still a number of functions that weren't updated for this support.  I initially started porting any functions I saw, but it wasn't a totally mechanical translation so I decided to do a little profiling to better direct my efforts.  I started by using the cProfile module to see what functions were called most frequently in Unladen Swallow's Django template benchmark.  Imagine my surprise when I saw that unicode.encode was called over 300,000 times!  A quick look at that function showed that it was a perfect contender for this optimization, it was currently designated as a METH_VARARGS, but in fact it's argument count was a finite range.  After about of dozen lines of code, to change the argument parsing, I ran the benchmark again, comparing it a control version of Unladen Swallow, and it showed a consistent 3-6% speedup on the Django benchmark.  Not bad for 30 minutes of work.<br /><br />Another optimization I want to look at, which hasn't landed yet, is one of optimize various operations.  Right now Unladen Swallow tracks various data about the types seen in the interpreter loop, however for various operators this data isn't actually used.  What this patch does is check at JIT compilation time whether the operator site is monomorphic (that is there is only one pair of types ever seen there), and if it is, and it is one of a few pairings that we have optimizations for (int + int, list[int], float - float for example) then optimized code is emitted.  This optimized code checks the types of both the arguments that they are the expected ones, if they are then the optimized code is executed, otherwise the VM bails back to the interpreter (various literature has shown that a single compiled optimized path is better than compiling both the fast and slow paths).  For simple algorithm code this optimization can show huge improvements.<br /><br />The PyPy project has <a href="http://morepypy.blogspot.com/2009/11/some-benchmarking.html">recently blogged</a> about the results of the results of some benchmarks from the Computer Language Shootout run on PyPy, Unladen Swallow, and CPython.  In these benchmarks Unladen Swallow showed that for highly algorithmic code (read: mathy) it could use some work, hopefully patches like this can help improve the situation markedly.  Once this patch lands I'm going to rerun these benchmarks to see how Unladen Swallow improves, I'm also going to add in some of the more macro benchmarks Unladen Swallow uses to see how it compares with PyPy in those.  Either way, seeing the tremendous improvements PyPy and Unladen Swallow have over CPython gives me tremendous hope for the future.<div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/7176062489626496619-5573208700261687615?l=lazypython.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://lazypython.blogspot.com/2009/11/another-pair-of-unladen-swallow.html]]></link>
    <pubDate>2009-11-19 23:51:15</pubDate>
  </item>
  <item>
    <title><![CDATA[Menno's Musings: Setting PYTHON_EGG_CACHE when deploying Python apps using FastCGI]]></title>
    <description><![CDATA[<p>I recently sorted out an issue with the <a class="reference external" href="http://imapclient.freshfoo.com/">IMAPClient</a> Trac instance
that's been bugging me for a while.</p>
<p>The problem was that whenever the web server logs were rotated
logrotate would restart <a class="reference external" href="http://www.lighttpd.net/">Lighttpd</a>. The web server restart would in
turn restart the Trac (FastCGI) processes. Unfortunately, the Trac
processes would fail to start with the following error.</p>
<pre class="literal-block">
pkg_resources.ExtractionError: Can't extract file(s) to egg cache

The following error occurred while trying to extract file(s) to the Python egg
cache:

  [Errno 13] Permission denied: '/root/.python-eggs'

The Python egg cache directory is currently set to:

  /root/.python-eggs
</pre>
<p>Bang, no <a class="reference external" href="http://imapclient.freshfoo.com/">IMAPClient</a> web site (the rest of the site was ok). To band-aid
the problem when it happened (and I noticed!) I issue a <tt class="docutils literal"><span class="pre">sudo</span>
<span class="pre">/etc/init.d/lighttpd</span> <span class="pre">restart</span></tt> and everything would be fine again.</p>
<p>After some investigation I found that running <tt class="docutils literal"><span class="pre">/etc/init.d/lighttpd</span>
<span class="pre">restart</span></tt> as root always triggered the problem where-as restarting
using sudo always worked. My guess is that restarting when logged in
as root was leaving $HOME at /root even after Lighttpd had dropped to
its unprivileged user account. The unprivileged user isn't allowed to
write to /root so Trac blows up. setuptools seems to use $HOME
instead of looking up the actual home directory of the current user.</p>
<p>The fix for me was to set the PYTHON_EGG_CACHE environment variable
for the FastCGI processes to somewhere they are allowed to write
to. This is done with the bin-environment option if you're using
Lighttpd like me.</p>
<p>I imagine similar problems can happen with any Python app deployed
using FastCGI.</p>]]></description>
    <link><![CDATA[http://freshfoo.com/blog/fastcgi-python-egg-cache]]></link>
    <pubDate>2009-11-19 17:48:00</pubDate>
  </item>
  <item>
    <title><![CDATA[BioPython News: Introducing (and expanding) the Biopython Cookbook]]></title>
    <description><![CDATA[<br /><p>Hi all,</p>
<p>You may have noticed we&#8217;re trying out using the wiki for <a href="http://biopython.org/wiki/Category:Cookbook">Biopython cookbook entries</a>. It&#8217;s a new idea so at the moment there are only a few &#8216;recipes&#8217; on offer.  If you have some tricks you find yourself using time and again to solve a problem why not share them? Similarly, if you find yourself coming up against a problem you can&#8217;t seem to solve easily with Biopython&#8217;s tools send a message to one of the <a href="http://biopython.org/wiki/Mailing_lists">mailing lists</a> proposing it as a cookbook example and someone just might solve it for you!</p>
<p>There are also several short examples in the main &#8220;<a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial and Cookbook</a>&#8221; (<a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">pdf version</a>) which might be worth copying/moving to the wiki.  What would you pick from here?</p>
<p>Feedback from <a href="http://www.biopython.org">Biopython</a> newcomers would be especially valuable! <span class="moz-smiley-s1"><span> <img src="http://news.open-bio.org/news/wp-includes/images/smilies/icon_smile.gif" alt=":)" class="wp-smiley" />  </span></span></p>]]></description>
    <link><![CDATA[http://news.open-bio.org/news/2009/04/biopython-cookbook-wiki/]]></link>
    <pubDate>2009-11-19 16:30:54</pubDate>
  </item>
  <item>
    <title><![CDATA[BioPython News: Dropping Python 2.3 Support]]></title>
    <description><![CDATA[<br /><p>As announced <a title="Biopython discussion archive" href="http://lists.open-bio.org/pipermail/biopython/2009-May/005148.html">here</a>, any last minute requests to postpone dropping support for Python 2.3 from the next release of <a href="http://biopython.org">Biopython</a> must be posted to the <a title="Biopython mailing lists" href="http://www.biopython.org/wiki/Mailing_lists">main Biopython mailing list</a> no later than Friday, May 8.</p>]]></description>
    <link><![CDATA[http://news.open-bio.org/news/2009/05/dropping-python23-support/]]></link>
    <pubDate>2009-11-19 16:30:45</pubDate>
  </item>
  <item>
    <title><![CDATA[BioPython News: Working with FASTQ files in Biopython when speed matters]]></title>
    <description><![CDATA[<br /><p><a href="http://news.open-bio.org/news/2009/08/biopython-1-51-released/">Biopython 1.51</a> onward includes support for Sanger, Solexa and Illumina 1.3+ FASTQ files in <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO</a>, which allows a lot of neat tricks very concisely. For example, the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">tutorial</a> (<a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>) has examples finding and removing primer or adaptor sequences.</p>
<p>However, because the Bio.SeqIO interface revolves around <a href="http://biopython.org/wiki/SeqRecord">SeqRecord objects</a> there is often a speed penalty. For example for <a href="http://en.wikipedia.org/wiki/FASTQ_format">FASTQ files</a>, the quality string gets turned into a list of integers on parsing, and then re-encoded back to ASCII on writing. </p>
<p>The new <a href="http://news.open-bio.org/news/2009/09/biopython-convert-function/">Bio.SeqIO.convert(&#8230;)</a> function in <a href="http://news.open-bio.org/news/2009/09/biopython-release-152/">Biopython 1.52</a> onwards makes converting from FASTQ to FASTA, or between the FASTQ variants about five times faster. It can do this because it doesn&#8217;t bother with creating any objects &#8211; it just uses Python strings.</p>
<p>You can use the same approach in your own scripts. For example, suppose you have a Solexa FASTQ file where you want to trim all the reads, taking just the first 21 bases (say). Why might you want to do this? Well, in Solexa/Illumina there is a general decline in read quality along the sequence, so it can make sense to trim, and some algorithms like to have all the input reads the same length. Here is how I would write this using the standard Bio.SeqIO functions:</p>
<p><code>
<pre>from Bio import SeqIO
records = (rec[:21] for rec in SeqIO.parse(open("untrimmed.fastq"), "fastq-solexa"))
handle = open("trimmed21.fastq", "w")
count = SeqIO.write(records, handle, "fastq-solexa")
handle.close()
print "Trimmed %i FASTQ records" % count</pre>
<p></p></code></p>
<p>This works, and is very simple and general. The same template can be used on any file formats supported by <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO</a>. However, it might be a bit slow for large next generation sequence files.</p>
<p>Instead, we can get a little more low level &#8211; and work directly with strings. This requires you to know more about the details of the FASTQ file format. Parsing FASTQ files is surprising complicated (with nasty things like line wrapping technically allowed), so we&#8217;ll still get Biopython to do that bit &#8211; but not bother with constructing SeqRecord objects and decoding the FASTQ quality strings. On the other hand, doing the FASTQ output explicitly isn&#8217;t actually too bad once you know how things work:</p>
<p><code>
<pre>from Bio.SeqIO.QualityIO import FastqGeneralIterator
trim = 21
handle = open("trimmed21.fastq", "w")
for title, seq, qual in FastqGeneralIterator(open("untrimmed.fastq")) :
&nbsp;&nbsp;&nbsp;&nbsp;handle.write("@%s\n%s\n+\n%s\n" % (title, seq[:trim], qual[:trim]))
handle.close()</pre>
<p></p></code></p>
<p>Again, the solution is a very short script &#8211; but this time it is much less flexible, and not nearly as clear what is going on. On the bright side, it is many times faster. Deciding on this trade-off is down to you, but I hope this blog post has highlighted the potential usefulness of the FastqGeneralIterator function in Bio.SeqIO.QualityIO, which you might otherwise have overlooked. To find out more, please read the built in documentation (also available <a title="Documentation for Bio.SeqIO.QualityIO function FastqGeneralIterator" href="http://biopython.org/DIST/docs/api/Bio.SeqIO.QualityIO-module.html#FastqGeneralIterator">online</a>):</p>
<p><code>&gt;&gt;&gt; from Bio.SeqIO.QualityIO import FastqGeneralIterator<br />
&gt;&gt;&gt; help(FastqGeneralIterator)<br />
...<br />
</code></p>
<p>Please sign up to the <a href="http://biopython.org/wiki/Mailing_lists">Biopython mailing list</a> if you want to discuss this topic further.</p>
<p>Peter</p>]]></description>
    <link><![CDATA[http://news.open-bio.org/news/2009/09/biopython-fast-fastq/]]></link>
    <pubDate>2009-11-19 16:30:30</pubDate>
  </item>
  <item>
    <title><![CDATA[BioPython News: Biopython 1.51 beta released]]></title>
    <description><![CDATA[<br /><p>A <em>beta</em> release for Biopython 1.51 is now available for download and testing.</p>
<p>In the two months since <a href="http://news.open-bio.org/news/2009/04/biopython-release-150/">Biopython 1.50</a> was released, we have introduced support for writing features in GenBank files using <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO</a>, extended <a href="http://news.open-bio.org/news/2009/03/biopython-next-gen-sequencing/">SeqIO&#8217;s support for the FASTQ format</a> to include files created by Illumina 1.3+, and added a new set of application wrappers for alignment programs, and made numerous tweaks and bug fixes.</p>
<p>All the new features have been tested by the dev team but it&#8217;s possible there are cases that we haven&#8217;t been able to foresee and test, especially for the GenBank feature writer (as there as just so many possible odd fuzzy feature locations).</p>
<p>Note that as previously announced, Biopython no longer supports <a href="http://news.open-bio.org/news/2009/05/dropping-python23-support/">Python 2.3</a>, and our deprecated parsing infrastructure (Martel and Bio.Mindy) has been removed.</p>
<p>Source distributions and Windows installers are available from the <a href="http://biopython.org/wiki/Download">downloads</a> page on the <a href="http://biopython.org">Biopython website (biopython.org)</a>.</p>
<p>We are interested in getting feedback on the beta release as a whole, but especially on the new features and the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial and Cookbook</a> (<a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>).</p>
<p>So, gather your courage, download the release, try it out and let us know what works and what doesn&#8217;t through the <a href="http://www.biopython.org/wiki/Mailing_lists">mailing lists</a> (or <a href="http://bugzilla.open-bio.org/">bugzilla</a>).</p>]]></description>
    <link><![CDATA[http://news.open-bio.org/news/2009/06/biopython-151-beta-released/]]></link>
    <pubDate>2009-11-19 16:30:14</pubDate>
  </item>
  <item>
    <title><![CDATA[BioPython News: Clever tricks with NCBI Entrez EInfo (&amp; Biopython)]]></title>
    <description><![CDATA[<br /><p>Constructing complicated NCBI Entrez searches can be tricky, but it turns out one of the <a href="http://eutils.ncbi.nlm.nih.gov/corehtml/query/static/eutils_help.html">Entrez Programming Utilities</a> called <a href="http://eutils.ncbi.nlm.nih.gov/corehtml/query/static/einfo_help.html">Entrez EInfo</a> can help.</p>
<p>For example, suppose you want to search for mitochondrial genomes from a given taxa &#8211; either just in the <a title="NCBI Entrez" href="http://www.ncbi.nlm.nih.gov/sites/entrez">Entrez web interface</a>, for use in a script with <a href="http://eutils.ncbi.nlm.nih.gov/corehtml/query/static/esearch_help.html>ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href="http://planet.python.org/>ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href="http://planet.python.org/>ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href="http://planet.python.org/>ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href="http://planet.python.org/>ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href="http://planet.python.org/>ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href="http://planet.python.org/>ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href="http://planet.python.org/>ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href=">ESearch</a> (where you might also download them with <a href="http://eutils.ncbi.nlm.nih.gov/corehtml/query/static/efetch_help.html">EFetch</a>).</p>
<p>I knew from past experience about using <code>name[ORGN]</code> in Entrez to search for an organism name &#8211; but how would you specify just mitochondria? I actually worked this out from the NCBI help and exploring the Entrez website&#8217;s advanced search &#8211; but it took a while.</p>
<p>There is an easier way to find out the search fields available in Entrez! Just recently I came across an interesting <a href="http://nsaunders.wordpress.com/2009/05/27/querying-ncbi-entrez-database-fields-using-ruby/">blog post from Neil Saunders</a> (written a couple of weeks ago) showing how Entrez EInfo provides information about the search fields in XML format, and how you can use Ruby to process this.</p>
<p><a href="http://biopython.org">Biopython</a> can do this too of course &#8211; using <a href="http://www.biopython.org/DIST/docs/tutorial/Tutorial.html#chapter:entrez">Bio.Entrez</a> this took just a few lines of Python:</p>
<p><code>&gt;&gt;&gt; from Bio import Entrez<br />
&gt;&gt;&gt; data = Entrez.read(Entrez.einfo(db="genome"))<br />
&gt;&gt;&gt; for field in data["DbInfo"]["FieldList"] :<br />
...     print "%(Name)s, %(FullName)s, %(Description)s" % field<br />
...<br />
ALL, All Fields, All terms from all searchable fields<br />
UID, UID, Unique number assigned to each sequence<br />
FILT, Filter, Limits the records<br />
WORD, Text Word, Free text associated with record<br />
TITL, Title, Words in definition line<br />
KYWD, Keyword, Nonstandardized terms provided by submitter<br />
AUTH, Author, Author(s) of publication<br />
JOUR, Journal, Journal abbreviation of publication<br />
VOL, Volume, Volume number of publication<br />
ISS, Issue, Issue number of publication<br />
PAGE, Page Number, Page number(s) of publication<br />
<strong>ORGN, Organism, Scientific and common names of organism, and all higher levels of taxonomy</strong><br />
ACCN, Accession, Accession number of sequence<br />
PACC, Primary Accession, Does not include retired secondary accessions<br />
GENE, Gene Name, Name of gene associated with sequence<br />
PROT, Protein Name, Name of protein associated with sequence<br />
ECNO, EC/RN Number, EC number for enzyme or CAS registry number<br />
PDAT, Publication Date, Date sequence added to GenBank<br />
MDAT, Modification Date, Date of last update<br />
SUBS, Substance Name, CAS chemical name or MEDLINE Substance Name<br />
PROP, Properties, Classification by source qualifiers and molecule type<br />
SQID, SeqID String, String identifier for sequence<br />
GPRJ, Genome Project, Genome Project<br />
SLEN, Sequence Length, Length of sequence<br />
FKEY, Feature key, Feature annotated on sequence<br />
RTYP, Replicon type, Replicon type<br />
RNAM, Replicon name, Replicon name<br />
<strong>ORGL, Organelle, Organelle</strong><br />
</code></p>
<p>That gives us a list of all the fields we can currently search on in the Genome database (and you could use the same code for any of the other NCBI databases in Entrez &#8211; they probably all have different searchable fields). Very handy! The ones in bold are discussed below.</p>
<p>So for my particular search, using &#8220;ORGL&#8221; to filter on organelle looks sensible, and after a bit of trial and error on the website I ended up with <code>mitochondrion[ORGL]</code> as a useful filter (not mitochondrial, or mitochondria).</p>
<p>I already knew about using &#8220;ORGN&#8221; to filter on the organism, either by species name or with a suitably formatted NCBI taxon ID (which you can get by searching or browsing the Entrez taxonomy database), e.g. <code>txid9443[ORGN]</code> gives <a href="http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9443">primates</a>.</p>
<p>Putting these together, to get <a href="http://www.ncbi.nlm.nih.gov/sites/entrez?db=genome&term=txid9443[ORGN]%20AND%20mitochondrion[ORGL]">all the primate mitochondria in the Entrez genome database</a> you could use:</p>
<blockquote><p>txid9443[ORGN] AND mitochondrion[ORGL]</p></blockquote>
<p>Note that you have to use &#8220;AND&#8221; in upper case.</p>
<p>I think we&#8217;ll have to add something along these lines to the <a href="http://www.biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial and Cookbook</a> (<a href="http://www.biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>)&#8230; <i>Update: That&#8217;s done now and will be included with our next release</i> <img src="http://news.open-bio.org/news/wp-includes/images/smilies/icon_smile.gif" alt=":)" class="wp-smiley" /> </p>
<p>Entrez rocks! (although their documentation could use a few more examples).</p>
<p>Peter</p>]]></description>
    <link><![CDATA[http://news.open-bio.org/news/2009/06/ncbi-einfo-biopython/]]></link>
    <pubDate>2009-11-19 16:30:07</pubDate>
  </item>
  <item>
    <title><![CDATA[BioPython News: Simpler, optimized format conversion with Biopython]]></title>
    <description><![CDATA[<br /><p>As per <a title="Indexing sequence files with Biopython" href="http://news.open-bio.org/news/2009/09/biopython-seqio-index/">Peter&#8217;s recent post</a> we are using this space to show of a couple of the new features in <a href="http://biopython.org">Biopython</a> 1.52 before it is released. In this post we&#8217;ll look at the new <strong>convert()</strong> function that both <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO</a> and <a href="http://biopython.org/wiki/AlignIO">Bio.AlignIO</a> will get in Biopython 1.52.</p>
<p>No one has ever complained that bioinformatics just doesn&#8217;t have enough file formats &#8211; you probably frequently find yourself converting sequence files to suit particular applications with <strong>Bio.SeqIO</strong>. At the moment this is usually a two step process, something like this:</p>
<p><code>&gt;&gt;&gt; records = SeqIO.parse(in_handle "genbank")<br />
&gt;&gt;&gt; SeqIO.write(records, out_handle, "fasta")</code></p>
<p>As of Biopython 1.52, you&#8217;ll be able to achieve the same result in a single step:</p>
<p><code>&gt;&gt;&gt; SeqIO.convert(in_handle, "genbank", out_handle, "fasta")</code></p>
<p>In fact, it&#8217;s even easier than that because the convert function will accept filename strings as well as file handles for both input and output.</p>
<p>Adding the convert function to <strong>Bio.SeqIO</strong> and <strong>Bio.AlignIO</strong> will make your scripts more readable and might even save you a couple of lines of code, but perhaps more importantly it allows for the conversion process to be optimized for the two formats being used. In most cases the same old parse and write functions are called internally, however some key conversions are much faster&#8230;</p>
<p>In the above example we are moving from a GenBank file, which probably includes multiple features for each sequence, to a FASTA file, which doesn&#8217;t include features. If we used the two step process above we&#8217;d be spending time reading each sequence&#8217;s features into memory just to skip them when they get passed to the write function. <strong>Bio.SeqIO.convert()</strong> knows that the sequences in the input file are destined to be written to a FASTA file so it can skip over the features and save a bit of time in doing the conversion.</p>
<p>Obviously, any optimization is most important when its used on very large files, like those produced in next generation sequencing projects. For example, when converting between each of the FASTQ file formats variants with the &#8220;SeqIO two step&#8221; a significant amount of time is taken creating <a href="http://biopython.org/wiki/SeqRecord">SeqRecord objects</a> for each record in the input file and decoding the quality scores into numbers. However, none of the attributes or methods of the SeqRecord object are required to do the conversion. For this reason <strong>Bio.SeqIO.convert()</strong> deals with each record as simple strings. This makes it about five times faster &#8211; on a par with converters written in C.</p>
<p>The Biopython 1.52 edition of the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial &#038; Cookbook</a> (<a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>) will cover these new convert functions in more detail.</p>]]></description>
    <link><![CDATA[http://news.open-bio.org/news/2009/09/biopython-convert-function/]]></link>
    <pubDate>2009-11-19 16:29:59</pubDate>
  </item>
  <item>
    <title><![CDATA[BioPython News: Indexing sequence files with Biopython]]></title>
    <description><![CDATA[<br /><p>The forthcoming release of <a href="http://biopython.org">Biopython</a> 1.52 will include a couple of nice improvements to the <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO module</a>, and here we&#8217;re going to introduce the new <strong>index</strong> function. This will of course be covered in the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial &amp; Cookbook</a> (<a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">PDF</a>) once this code is released.</p>
<p>Suppose you have a <em>large</em> sequence file with many many individual sequences in it. This could be next generation sequence data for example, maybe a FASTQ, FASTA or QUAL file. Or, it might be a big annotation rich file, such as the whole of UniProt, or a chunk of GenBank.</p>
<p>The <strong>Bio.SeqIO.parse(&#8230;)</strong> function lets you iterate over all the records in a file, one by one. This allows you to process each sequence in turn, keeping only one in memory at a time. This approach is <em>very</em> valuable for dealing with big files.</p>
<p>However, sometimes you can&#8217;t just loop over the records in the order found in the file. You may <em>require</em> random access. In Python, the natural API here is a dictionary &#8211; for example looking up the records via their ID string. This is how the existing <strong>Bio.SeqIO.to_dict(&#8230;)</strong> function works. It is just  a helper function to build an <em>in memory</em> dictionary of a collection of SeqRecord objects. However, because everything is kept in memory (RAM), this only works on small or medium sized files. <img src="http://news.open-bio.org/news/wp-includes/images/smilies/icon_sad.gif" alt=":(" class="wp-smiley" /> </p>
<p>So, what should you do when you have a very large file, and it is no longer possible to load everything into memory at once? Well, you might consider using a <a href="http://biosql.org">BioSQL</a> database &#8211; this is probably quite a sensible option for something like GenBank data. However, for next generation sequencing data this is probably overkill. This is where the new <strong>Bio.SeqIO.index(&#8230;)</strong> function comes in. It behaves like a Python dictionary, but doesn&#8217;t keep everything in memory at once!</p>
<p>What <strong>Bio.SeqIO.index(&#8230;)</strong> does is first quickly scan the file looking for the position of each new record, and records this information against the record ID string. This still requires a reasonable amount of memory, but works fine even for millions of entries in a file. Then, when you ask for a particular record, it jumps to the relevant part of the file, and then parses the data into a SeqRecord.</p>
<p>For example, consider the FASTQ file SRR014849.fastq (available <a href="ftp://ftp.ncbi.nlm.nih.gov/sra/static/SRX003/SRX003639/SRR014849.fastq.gz">compressed at the NCBI</a>). The <strong>Bio.SeqIO.index(&#8230;)</strong> function takes a minimum of two arguments, the filename and the file format:</p>
<p><code><br />
&gt;&gt;&gt; from Bio import SeqIO<br />
&gt;&gt;&gt; data = SeqIO.index("SRR014849.fastq", "fastq")<br />
&gt;&gt;&gt; len(data)<br />
94696<br />
&gt;&gt;&gt; data.keys()[:3]<br />
['SRR014849.80961', 'SRR014849.80960', 'SRR014849.80963']<br />
&gt;&gt;&gt; print data["SRR014849.290838"].seq<br />
TGAGAATTTTTATTTTCAAGGGTTGGAACCGAAGGGTTTGAATTCAAACCCTTTCGGTTCCAACCCGACAAGTCATCGATGTTG<br />
&gt;&gt;&gt; print data["SRR014849.290838"].letter_annotations["phred_quality"]<br />
[20, 18, 24, 25, 33, 26, 37, 33, 22, 11, 1, 22, 37, 33, 22, 10, 25, 31, 26, 36, 32, 16, 33, 26, 31, 25, 33, 25, 31, 25, 22, 33, 26, 35, 30, 12, 35, 31, 17, 19, 30, 20, 33, 26, 27, 31, 27, 6, 36, 32, 15, 33, 29, 10, 27, 32, 24, 30, 25, 30, 20, 24, 13, 35, 31, 13, 27, 26, 28, 32, 24, 28, 28, 27, 22, 22, 26, 28, 26, 24, 27, 30, 22, 27]</code></p>
<p>In this case the FASTQ file is only 24MB (so the example is easy to try at home), but the same approach works just as well on a 1GB FASTQ file <img src="http://news.open-bio.org/news/wp-includes/images/smilies/icon_smile.gif" alt=":)" class="wp-smiley" /> </p>
<p>This will be covered in more detail by the new edition of the <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">Biopython Tutorial &amp; Cookbook</a>, and once you have Biopython 1.52 or later installed don&#8217;t forget about the built in help:</p>
<p><code>&gt;&gt;&gt; from Bio import SeqIO<br />
&gt;&gt;&gt; help(SeqIO.index)<br />
...<br />
</code></p>
<p>Biopython 1.52 will index most of the file formats that can already be parsed with the SeqIO library &#8211; but not any multiple alignment formats. There is a table on the <a href="http://biopython.org/wiki/SeqIO">Bio.SeqIO wiki page</a>.</p>
<p>Enjoy!</p>
<p>Peter</p>
<p>P.S. Note that random access to all the records in a sequence file isn&#8217;t the only potential benefit of using <strong>Bio.SeqIO.index(&#8230;)</strong>. Suppose you are only interested in a few entries in a large file. You could use a for loop with <strong>Bio.SeqIO.parse(&#8230;)</strong>, but this will mean every single record gets parsed and turned into a SeqRecord. If instead you used <strong>Bio.SeqIO.index(&#8230;)</strong> then only the few records you care about get parsed and turned into SeqRecord objects. This can save a lot of time, especially for an annotation rich format like SwissProt or GenBank.</p>]]></description>
    <link><![CDATA[http://news.open-bio.org/news/2009/09/biopython-seqio-index/]]></link>
    <pubDate>2009-11-19 16:29:53</pubDate>
  </item>
  <item>
    <title><![CDATA[BioPython News: Biopython 1.51 released]]></title>
    <description><![CDATA[<br /><p>We are pleased to announce the release of Biopython 1.51.This  new stable release enhances  <a title="1.50 announcement" href="http://news.open-bio.org/news/2009/04/biopython-release-150/">version 1.50</a> (released in April) by extending  the functionality of existing modules, adding a set of application wrappers for popular alignment programs and fixing a number of minor bugs.</p>
<p>In particular, the SeqIO module can now write Genbank files that include features, and deal with FASTQ files created by Illumina 1.3+. Support for this format allows interconversion between FASTQ files using  Solexa, Sanger and Ilumina variants using conventions agreed upon with the <a title="BioPerl main page" href="http://www.bioperl.org/wiki/Main_Page">BioPerl</a> and <a title="EMBOSS page" href="http://emboss.sourceforge.net/">EMBOSS</a> projects.</p>
<p>Biopython 1.51 is the first stable release to include the Align.Applications  module which allows users to define command line wrappers for popular alignment programs including <a title="Clustal Hompage" href="http://www.clustal.org/">ClustalW</a>, <a title="Muscle homepage" href="http://www.drive5.com/muscle/">Muscle</a> and <a title="T-Coffe Hompage" href="http://www.tcoffee.org/Projects_home_page/t_coffee_home_page.html">T-Coffee</a>.</p>
<p>Bio.Fasta and the application tools  ApplicationResult and generic_run() have been marked as <a title="Deprecation Policy" href="http://biopython.org/wiki/Deprecation_policy">deprecated</a> &#8211; Bio.Fasta has been superseded by SeqIO&#8217;s support for the Fasta format and we provide ducumentation for using the <a title="subprocess documentation" href="http://docs.python.org/library/subprocess.html">subprocess</a> module from the Python Standard Library as a more flexible approach to calling applications.</p>
<p>As always the <a title="Biopython Tutorial" href="http://www.biopython.org/DIST/docs/tutorial/Tutorial.html">Tutorial and Cookbook </a>has been updated to document all the changes.</p>
<p>Thank you to everyone who tested our 1.51 beta or submitted bugs since out last stable release and to all our contributors</p>
<p>Sources and Windows Installer are available from the <a title="Biopython Downloads" href="http://biopython.org/wiki/Download">downloads page</a>.</p>]]></description>
    <link><![CDATA[http://news.open-bio.org/news/2009/08/biopython-1-51-released/]]></link>
    <pubDate>2009-11-19 16:29:47</pubDate>
  </item>
  <item>
    <title><![CDATA[BioPython News: Biopython 1.52 released]]></title>
    <description><![CDATA[<br /><p>We are pleased to announce the availability of Biopython 1.52, a new stable release of the <a href="http://biopython.org">Biopython</a> library.</p>
<p>It may only have been one month since <a title="Biopython 1.51" href="http://news.open-bio.org/news/2009/08/biopython-1-51-released/">the last release</a>, but in that time we&#8217;ve added enough useful features to warrant a new release. In particular, Biopython 1.52 includes more substantial support for population genetics, and adds new functions that will be useful for people working with next generation sequencing.</p>
<p>Tiago Antao&#8217;s work on the Population Genetics module  brings a command line wrapper for GenePop which allows the estimation of  <a href="http://en.wikipedia.org/wiki/F-statistics">F-statistics</a>, null allele frequencies and migration rates as well as tests for isolation by distance (IBD) and deviation from Hardy-Weinberg equilibrium.</p>
<p>Bio.SeqIO and Bio.AlignIO both now have a <a href="http://news.open-bio.org/news/2009/09/biopython-convert-function/">new <strong>convert()</strong> function</a> that allows for simple (and potentially optimized) conversion between file formats. Bio.SeqIO also gets a <a title="Indexing sequence files with Biopython" href="http://news.open-bio.org/news/2009/09/biopython-seqio-index/">new <strong>index()</strong> function</a> which allows random access to sequences in a file without reading every record in that file into memory.</p>
<p>The new release also adds command line wrappers for the <a title="Emboss Embassy packages" href="http://emboss.sourceforge.net/embassy/#PHYLIP">EMBOSS versions</a> of the <a title="Joe Felsenstein's Phylip page" href="http://evolution.genetics.washington.edu/phylip.html">PHYLIP phylogeny programs</a> and the <a href="http://www.novocraft.com/products.html#novoalign">Novoalign assembler from NovaCraft</a> &#8211; plus squashes a few minor bugs reported since 1.51 was released.</p>
<p>Biopython 1.52 will be the last release to use the CVS server as the main repository for code in development. From now on the <a title="Biopython on github" href="http://github.com/biopython/biopython">official development branch will be on github</a>, would-be developers can see our wiki page on <a title="Biopython wiki article on git usage" href="http://www.biopython.org/wiki/GitUsage">git usage</a> to see the benefits on this system.</p>
<p>Sources and Windows Installers are available from the <a title="Download Biopython" href="http://www.biopython.org/wiki/Download">downloads page</a>.</p>
<p>Thanks to the Biopython development team and to everyone who has reported bugs since our last release.</p>]]></description>
    <link><![CDATA[http://news.open-bio.org/news/2009/09/biopython-release-152/]]></link>
    <pubDate>2009-11-19 16:29:36</pubDate>
  </item>
  <item>
    <title><![CDATA[BioPython News: Biopython CVS to git migration]]></title>
    <description><![CDATA[<br /><p>The release of <a href="http://news.open-bio.org/news/2009/09/biopython-release-152/">Biopython 1.52</a> earlier this week marked the end of an era, it was our last release using CVS for source code control.</p>
<p>As of now, Biopython is using a <a title="Biopython on github" href="http://github.com/biopython/biopython">git repository</a>, hosted on <a href="http://github.com">github.com</a> who kindly provide git hosting for open source projects free of charge. The <a href="http://bioruby.org">BioRuby project</a> have been <a title="BioRuby on github" href="http://github.com/bioruby/bioruby">using github</a> for some time, so we are in good company.</p>
<p>Our existing OBF hosted CVS repository will be maintained in the short to medium term as a backup, but will not be updated.</p>
<p>Although many people have been involved in this move, we&#8217;d like to thank Bartek Wilczynski in particular for handling the CVS to git conversion, and the mirroring our CVS updates to git during the transition period. In the next few weeks hopefully we&#8217;ll get our <a href="http://biopython.org/wiki/GitUsage">git usage wiki pages</a> perfected, as we start using git for real.</p>]]></description>
    <link><![CDATA[http://news.open-bio.org/news/2009/09/biopython-cvs-to-git-migration/]]></link>
    <pubDate>2009-11-19 16:29:27</pubDate>
  </item>
  <item>
    <title><![CDATA[The PyCon blog: PyCon poster session deadline: Nov. 30]]></title>
    <description><![CDATA[The deadline for PyCon poster proposals is coming up soon - November 30!<br /><br />Poster Sessions are a new PyCon feature for 2010.  Poster sessions provide an alternative presentation mechanism that facilitates more one-on-one communication between the presenter and the audience. Poster sessions are particularly suited for topics of interest to a subset of the community, and we anticipate these sessions will provide an "incubator" for further discussions.<br /><br />More information about the what, how, when, and why of poster sessions is at <a href="http://us.pycon.org/2010/conference/posters/cfp/">http://us.pycon.org/2010/conference/posters/cfp/</a>.<div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/11638628-3146925085321002026?l=pycon.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://pycon.blogspot.com/2009/11/pycon-poster-session-deadline-nov-30.html]]></link>
    <pubDate>2009-11-19 16:21:33</pubDate>
  </item>
  <item>
    <title><![CDATA[Alvaro Lopez Ortega: Cherokee Web Server Introductory Screencast]]></title>
    <description><![CDATA[<p>We have recently uploaded our very first <a href="http://www.cherokee-project.com/">Cherokee</a> Web Server <a href="http://www.vimeo.com/7683565">introductory screencast</a>. It's a 5 minutes video to introduce the Cherokee configuration interface:</p>  

<div align="center"></div>

<p>We will record more videos in the upcoming weeks.  Hopefully they will help us to show the World the cool features that Cherokee offers.  Enjoy it!</p>]]></description>
    <link><![CDATA[http://www.alobbs.com/1376/Cherokee_Web_Server_Introductory_Screencast.html]]></link>
    <pubDate>2009-11-19 13:09:01</pubDate>
  </item>
  <item>
    <title><![CDATA[Christopher Denter: PyMT (Multi-Touch with Python)]]></title>
    <description><![CDATA[<p>For those of you who don’t know it, if something provides <em>Multi-Touch</em> input methods, it means that you (and potentially an almost arbitrary number of other people) can interact with the same device using as many of your fingers as you like.</p>

<img src="http://the-space-station.com/~dennda/gallery/mt/multitouch_infovis.png" alt="Multi-Touch helps to visualize information (image)" />

<p>This technique is relatively new to most of us and I have been blown away when I first saw a video of someone interacting with a so-called <em>Multi-Touch table</em>:</p>

<p>(If you’re reading this posting via a planet or feed reader, please click this posting’s title to see the videos on my blog directly.)</p>



<p>In case you like the python programming language, you might be as excited as I was to know that there’s actually a library that allows you to write multi-touch software yourself. This library is <a href="http://pymt.txzone.net">PyMT</a>. It’s based on top of OpenGL and allows you to deal with multi-touch input events in a nicely abstracted way. PyMT is cross-platform, open-source and actively developed. It comes with many examples, a mouse simulator (in case you don’t have such a table) and (in the development branch) support for the new touchpads found in recent macbooks as well as other types of hardware (HP touchsmart, etc.). Here’s an old demo video that shows what PyMT is capable of already:</p>



<p>I was so impressed by what is possible that I started diving into the matter quite some time ago. I’m even building my own table at the moment. The thesis I’m currently working on also relies on PyMT. If you got an appetite, feel free to join us in #pymt on irc.freenode.net or the mailing lists.</p>

<p>In order to show you how easy it can be, <a href="http://paste.pocoo.org/show/151634/">here’s a quick demo</a> I just wrote.</p>

<p>If you are interested in building your own hardware (yes, you can), let me suggest you take a look at the excellent <a href="http://nuigroup.com">NUI community</a>. They have software, forums and even a book available for free for you to learn and explore.</p>]]></description>
    <link><![CDATA[http://the-space-station.com/2009/11/19/pymt-multi-touch-with-python]]></link>
    <pubDate>2009-11-19 12:02:53</pubDate>
  </item>
  <item>
    <title><![CDATA[Grig Gheorghiu: 5 years of blogging]]></title>
    <description><![CDATA[Today marks the 5th anniversary of my blog. It's been a fun and rewarding experience, and I hope to never run out of interesting topics to post about ;-)<br /><br />As a sort of retrospective, I was curious to see which of my blog posts have been getting the most traffic. Here's the top 10 over the last 9 months, according to Google Analytics:<br /><br />1. <a href="http://agiletesting.blogspot.com/2005/02/performance-vs-load-vs-stress-testing.html">Performance vs. load vs. stress testing</a> (as an aside, I think this has been wildly popular because I inadvertently hit on a lot of keywords in the title)<br />2. <a href="http://agiletesting.blogspot.com/2009/04/experiences-deploying-large-scale.html">Experiences deploying a large-scale infrastructure in Amazon EC2</a><br />3. <a href="http://agiletesting.blogspot.com/2006/03/ajax-testing-with-selenium-using_21.html">Ajax testing with Selenium using waitForCondition</a><br />4. <a href="http://agiletesting.blogspot.com/2006/01/useful-tools-for-writing-selenium.html">Useful tools for writing Selenium tests</a><br />5. <a href="http://agiletesting.blogspot.com/2009/02/load-balancing-in-amazon-ec2-with.html">Load balancing in EC2 with HAProxy</a><br />6. <a href="http://agiletesting.blogspot.com/2005/01/python-unit-testing-part-1-unittest.html">Python unit testing part 1: the unittest module</a><br />7. <a href="http://agiletesting.blogspot.com/2005/04/http-performance-testing-with-httperf.html">HTTP performance testing with httperf, autobench and openload</a><br />8. <a href="http://agiletesting.blogspot.com/2005/09/running-python-script-as-windows.html">Running a Python script as a Windows service</a><br />9. <a href="http://agiletesting.blogspot.com/2007/05/apache-virtual-hosting-with-tomcat-and.html">Apache virtual hosting with Tomcat and mod_jk</a><br />10. <a href="http://agiletesting.blogspot.com/2005/10/configuring-apache-2-and-tomcat-55.html">Configuring Apache 2 and Tomcat 5.5 with mod_jk</a><br /><br />It's interesting that 2 of the top 5 posts are Selenium-related. I think Selenium documentation is not where it needs to be generally speaking, hence people find my old posts on this topic. <a href="http://adam.goucher.ca/">Adam</a>, you really need to write a Selenium RC book!<div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/9238405-5900250561124751073?l=agiletesting.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://agiletesting.blogspot.com/2009/11/5-years-of-blogging.html]]></link>
    <pubDate>2009-11-19 10:02:37</pubDate>
  </item>
  <item>
    <title><![CDATA[Fabio Zadrozny: Pydev 1.5.1 released]]></title>
    <description><![CDATA[Yeap, this release took more time than usually, but I hope it was worth it. The major things as I posted previously were related to the refactoring engine.<br /><br />There were also a number of other minor problems and features done along the way. <br /><br />The complete info may be found at: <a href="http://pydev.org/">http://pydev.org/</a><br /><br />So, now that it's out, what's next?<br /><br />Well, the last releases were all about giving more power to the user (refactoring, jump in the debugger, app engine, merging pydev extensions to pydev, Iron Python support -- did I mention that the pydev debugger is now working with the latest Iron Python?), so, I think that now would be a good time to step back a little and work on ironing out the bugs and making some profiling sessions (for both speed and memory).<div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/8550962-8532521643490548543?l=pydev.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://pydev.blogspot.com/2009/11/pydev-151-released.html]]></link>
    <pubDate>2009-11-19 09:42:10</pubDate>
  </item>
  <item>
    <title><![CDATA[Michele Simionato: Clearing caches]]></title>
    <description><![CDATA[A short note about a task I am doing at my day job, involving making sure that different caches are cleared consistently. For people wondering about real-life use cases of metaprogramming techniques.]]></description>
    <link><![CDATA[http://www.artima.com/weblogs/viewpost.jsp?thread=274438]]></link>
    <pubDate>2009-11-19 09:40:19</pubDate>
  </item>
  <item>
    <title><![CDATA[Steve Holden: Links for 2009-11-18 [del.icio.us]]]></title>
    <description><![CDATA[<ul>
<li><a href="http://holdenweb.eventbrite.com/">Events organized by Holden Web, LLC</a><br />
January will be a busy month in New York</li>
</ul><img src="http://feeds.feedburner.com/~r/ForSomeValueOfMagic/~4/AEzNGMnCl5w" height="1" width="1" />]]></description>
    <link><![CDATA[http://feedproxy.google.com/~r/ForSomeValueOfMagic/~3/AEzNGMnCl5w/steve.holden]]></link>
    <pubDate>2009-11-19 08:00:00</pubDate>
  </item>
  <item>
    <title><![CDATA[Flavio Coelho: Developing a Wave Robot in Python]]></title>
    <description><![CDATA[I have been so busy lately that I almost forgot to write about my lightning venture into writing a Google Wave robot: Trendy.For those of you living under a rock in the last several months, Google Wave offers an API for the development of robot, which are... well, robots, which when added to waves, do automated tasks with its contents. There are robots for translating, do syntax highlighting on]]></description>
    <link><![CDATA[http://feedproxy.google.com/~r/PythonInScience/~3/eUcxueWYebE/dveloping-wave-robot.html]]></link>
    <pubDate>2009-11-19 06:45:28</pubDate>
  </item>
  <item>
    <title><![CDATA[Carl Trachte: Unicode Normalization - Python 3.x Unicode Identifiers]]></title>
    <description><![CDATA[As part of my effort to get up to speed on Unicode as it relates to Python 3.x identifiers (variables), I'm going to step back from my previous posts about the more exotic languages to something more basic in a Latin script.&nbsp; While I hope to demonstrate the concept of Unicode normalization in Asian scripts in a future post, I need to walk before I run.<br /><br />(Aside: &nbsp;this is part of preparation for a poster submission I have done for Pycon 2010.&nbsp; Although it's too late to submit a talk, you can still submit a proposal for a poster presentation until, IIRC, the end of this month:&nbsp; <a href="http://us.pycon.org/2010/conference/posters/">Pycon 2010 poster information page</a>.&nbsp; While I'd like to see my submission accepted, if you've created economic nuclear fission, a cure for cancer or the common cold, or just a series of poster sessions that blow mine away, I'd graciously accept the loss.&nbsp; Pycon 2010 has a great deal of good momentum on the technical end - there's still time to be part of that.)<br /><br />To the Python interpreter!<br /><b>&gt;&gt;&gt;</b><b><span> <span>import</span> unicodedata</span></b><br /><div><b><span>&gt;&gt;&gt;</span> singlecodepointvar = <span>chr</span><span>(228)</span></b><br /></div><b><span><span>&gt;&gt;&gt;</span><span> singlecodepointvar </span><br /></span></b><br /><div><b>'ä'</b><br /></div><div><b><span>&gt;&gt;&gt;</span> <span>decomposedunicodevar = unicodedata.decomposition(singlecodepointvar)</span><br /><span>&gt;&gt;&gt;</span> <span>decomposedunicodevar</span><br />'0061 0308'<br /><span>&gt;&gt;&gt;</span> <span>decomposedunicodevar =</span> <span>chr</span><span>(0x61)</span> + <span>chr</span><span>(0x308)</span><br /><span>&gt;&gt;&gt;</span> <span>decomposedunicodevar</span><br />'ä'</b><br /></div><div><b><span>&gt;&gt;&gt;</span> <span># that may or may not have shown up correctly in your browser</span></b><br /></div><div><b><span>&gt;&gt;&gt;</span> <span># I've had mixed luck with the decomposed </span></b><b>ä</b><br /><b><span>&gt;&gt;&gt;</span> <span># string literals do not get normalized (made to be equal)</span><br /><span>&gt;&gt;&gt;</span> <span>singlecodepointvar == decomposedunicodevar</span><br /><span>False</span><br /><span>&gt;&gt;&gt;</span> <span>len</span><span>(singlecodepointvar)</span><br /><span>1</span><br /><span>&gt;&gt;&gt;</span> <span>len</span><span>(decomposedunicodevar)</span><br /><span>2</span><br /><span>&gt;&gt;&gt;</span> <span>unicodedata.name(singlecodepointvar[0])</span><br />'LATIN SMALL LETTER A WITH DIAERESIS'<br /><span>&gt;&gt;&gt;</span> <span>unicodedata.name(decomposedunicodevar[0])</span><br />'LATIN SMALL LETTER A'<br /><span>&gt;&gt;&gt;</span> <span>unicodedata.name(decomposedunicodevar[1])</span><br />'COMBINING DIAERESIS'<br /><span>&gt;&gt;&gt;</span> <span># copy and paste two same looking string literals for good measure</span><br />&gt;&gt;&gt; 'ä' <span>==</span> 'ä'<br /><span>False</span><br /><span>&gt;&gt;&gt;</span> <span># now, demonstrate normalization for identifiers</span><br /><span>&gt;&gt;&gt;</span> # using regular a umlaut as identifer (chr(228))<br /><span>&gt;&gt;&gt;</span> <span>ä = 22</span><br /><span>&gt;&gt;&gt;</span> <span># now using length two decomposed a with umlaut (chr(0x61) + chr(0x308))</span><br /><span>&gt;&gt;&gt;</span> <span>ä = 44</span><br /><span>&gt;&gt;&gt;</span> <span># eval single codepoint</span><br /><span>&gt;&gt;&gt;</span> <span>eval</span><span>(</span><span>chr</span><span>(228))</span><br /><span>44</span><br /><span>&gt;&gt;&gt;</span> <span># same - now eval decomposed a with umlaut</span><br /><span>&gt;&gt;&gt;</span> <span>eval</span><span>(</span><span>chr</span><span>(0x61) + </span><span>chr</span><span>(0x308))</span><br /><span>44</span><br /><span>&gt;&gt;&gt;</span> <span># same again</span><br /><span>&gt;&gt;&gt;</span> <span># how is it stored?</span><br /><span>&gt;&gt;&gt;</span> <span>globals</span><span>()</span><br /><span>{<span>'ä'</span>: 44,</span></b><b><span> . . . a bunch of other variables . . .}</span><br /><span>&gt;&gt;&gt;</span> <span># copy and paste identifier</span><br /><span>&gt;&gt;&gt;</span> <span>len</span><span>(</span>'ä'<span>)</span><br /><span>1</span><br /><span>&gt;&gt;&gt;</span> <span>ord</span><span>(</span>'ä'<span>)</span><br /><span>228</span><br /><span>&gt;&gt;&gt;</span> <span># OK - it goes with the single codepoint 228<br /></span></b><br /></div><div><b><span><span>&gt;&gt;&gt;</span> # normalization of string literals </span><br /><span>&gt;&gt;&gt;</span> <span>a =</span> <span>chr</span><span>(0x61) +</span> <span>chr</span><span>(0x308)</span><br /><span>&gt;&gt;&gt;</span> <span>a</span><br />'ä'<br /><span>&gt;&gt;&gt;</span> <span>b = unicodedata.normalize(</span>'NFKC'<span>,</span> <span>a)</span><br /><span>&gt;&gt;&gt;</span> <span>b</span><br />'ä'<br /><span>&gt;&gt;&gt;</span> <span>len</span><span>(b)</span><br /><span>1</span><br /><span>&gt;&gt;&gt;</span> <span>len</span><span>(a)</span><br /><span>2</span><br /><span>&gt;&gt;&gt;</span> <span>ord</span><span>(b)</span><br /><span>228</span></b><br /></div><div><b><span><span>&gt;&gt;&gt;</span> <span># normalizes to single code point 228</span></span><br />&nbsp;</b><br /></div><div><span>OK, that's a simple example of Unicode normalization as it applies to Python 3.x identifiers and Python 3.x string literals.&nbsp; I really beat this point to death, but seeing is believing.&nbsp;&nbsp;</span><br /></div><div><br /></div><div><span>Next time I delve into this topic I hope to do so with some East Asian characters.&nbsp; Until then, happy unicoding (if google is a verb, why not?) in Python 3.x.</span><b><br /></b><br /></div><div class="blogger-post-footer"><img width="1" height="1" src="https://blogger.googleusercontent.com/tracker/524230429673765509-7717950382354215670?l=pyright.blogspot.com" alt="" /></div>]]></description>
    <link><![CDATA[http://pyright.blogspot.com/2009/11/unicode-normalization-python-3x-unicode.html]]></link>
    <pubDate>2009-11-19 04:06:00</pubDate>
  </item>
  <item>
    <title><![CDATA[Mike C. Fletcher: Framebuffer Object shadows]]></title>
    <description><![CDATA[<p>I also added a FrameBufferObject implementation to the "special effects" tutorial path for OpenGLContext.  This uses the convenience wrapper for frame buffer objects which I just added to PyOpenGL.  The convenience wrapper just makes the ARB and EXT variants of the entry points available via alternates and provides a checkFramebufferStatus function which implements the ARB extensions suggested check operation (with a raised GLError if there's a problem).  That should all show up on the next release, as it will need the newest PyOpenGL release.</p><p>At the moment I'm still not very satisfied with the results.  Even with a 2048x2048 depth texture I'm seeing very obvious pixellation in the shadows.  I'm guessing either floating-point-precision issues or problems with the setup of the scene (OpenGLContext is very conservative with clipping planes, so there's a lot of depth-buffer "compression" going on as the depth buffer goes way off into the distance).  I looked into doing multisampling on the depth texture, but that seems to require doing a pixel copy into the texture, which somewhat obviates the value of the direct-to-texture (off-screen) rendering approach.</p><p>I also found and fixed a large set of errors in the auto-generated extension wrappers.  I also tweaked the docstrings generated.  The errors found were that the glGet* constants were not getting registered because the OpenGL extension registry has moved (duh!).  I'm thinking I need to spend some quality time with at least the extensions on my machine and make sure that we've got all image-formats, array retrieval, etceteras properly noted and wrapped.  Not this week, though.</p>]]></description>
    <link><![CDATA[http://blog.vrplumber.com/index.php?/archives/2401-Framebuffer-Object-shadows.html]]></link>
    <pubDate>2009-11-19 03:26:47</pubDate>
  </item>
  <item>
    <title><![CDATA[Mike C. Fletcher: Research in Action]]></title>
    <description><![CDATA[<p>The other event of the day yesterday was University of Toronto's Research in Action show.  This is a booth-based presentation of various research, whether formal or informal, being done at the University.  My interest is primarily in figuring out how to:</p><ul><li>Use Open Source to make it easier for researchers to make their work relevant</li><li>Create a path to let research results flow into Open Source (effectively, addressing code quality issues, community mismatch and the like)</li><li>Find a way to have development projects feed (research) needs into the research community &quot;We need something that can do this novel thing&quot;</li></ul><p>Going to be putting together thoughts on this to discuss with members of the University community over the next few days.</p>]]></description>
    <link><![CDATA[http://blog.vrplumber.com/index.php?/archives/2400-Research-in-Action.html]]></link>
    <pubDate>2009-11-19 03:17:27</pubDate>
  </item>
  <item>
    <title><![CDATA[Mike C. Fletcher: Code-dojo seemed to work well]]></title>
    <description><![CDATA[<p>We decided to use the <a href="http://norvig.com/spell-correct.html">21-line spell checker</a> as a sample case for playing with Cython last night.  We immediately ran into a few uses of not-yet-supported features (at least, in the default Ubuntu version of Cython), things like lambdas, generator comprehensions, etceteras).  We spent a while playing with moving code about in modules to convince ourselves things worked the way we though.  We also spent quite a while trying to get something beyond the initial 20% speedup of just copying the file into a .pyx and compiling it... we wound up getting an additional 2% by declaring lots of internal variables string, declaring a few return types as set, etceteras.</p><p>What?  You call that working well?</p><p>Why yes, I do.  It worked well because we let new Python users actually code; we had people solving problems together and learning how the others do that; basically it was a reasonable knowledge transfer session, though the knowledge really wasn't about Cython at all, it was more about methods and approaches, with a bit of Cython thrown in.</p>]]></description>
    <link><![CDATA[http://blog.vrplumber.com/index.php?/archives/2399-Code-dojo-seemed-to-work-well.html]]></link>
    <pubDate>2009-11-19 03:05:52</pubDate>
  </item>
</channel>
</rss>
